Nordstromia japonica

Moore, 1877 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Drepanidae/Nordstromia

At a glance

Occurrence records1 389

Data sources7

Biological traits0

DNA specimens7

eDNA detections7

Sources7 archives

Databases and archives Nordstromia japonica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 389 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Nordstromia japonica is a species of moth belonging to the subfamily Drepaninae. It is found in Japan and China (Hunan and Szechwan). The wingspan is 25–37 mm.Japanese Moths Adults are pale vinous lavender grey, with two narrow brown-bordered, yellow, obliquely transverse bands on both wings. The outer band crosses from the apex to the middle of the abdominal margin and the inner band from the middle of the costa to one-third the latter. The costal edge and apex of the forewings are ochreous yellow. There is a slight curved brown streak on the forewings and a small spot on the hindwings at the end of the cell.Annals and Magazine of Natural History (4) 20 (116): 94

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nordstromia japonica has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes1

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 63 variable positions, in barcode order

13Cmostly conserved

18Tmostly conserved

67Amostly conserved

76Amostly conserved

100Tmostly conserved

103Cmostly conserved

127Amostly conserved

154Tmostly conserved

160Gmostly conserved

163Avariable

194Tmostly conserved

200Amostly conserved

202Cmostly conserved

205Amostly conserved

206Tmostly conserved

207Tmostly conserved

208Amostly conserved

209Amostly conserved

212Cmostly conserved

220Tmostly conserved

274Tmostly conserved

277Amostly conserved

278Cmostly conserved

283Amostly conserved

284Cmostly conserved

286Tmostly conserved

287Tmostly conserved

292Cmostly conserved

295Amostly conserved

319Amostly conserved

340Tmostly conserved

376Cvariable

379Amostly conserved

400Cvariable

401Cmostly conserved

403Amostly conserved

406Tmostly conserved

428Cmostly conserved

433Gvariable

445Cmostly conserved

451Amostly conserved

463Tmostly conserved

469Amostly conserved

484Gmostly conserved

490Tmostly conserved

500Cmostly conserved

505Tmostly conserved

514Tmostly conserved

517Gmostly conserved

539Cmostly conserved

541Tmostly conserved

542Tmostly conserved

547Avariable

553Amostly conserved

562Gmostly conserved

574Tvariable

586Tmostly conserved

610Cmostly conserved

616Tmostly conserved

625Amostly conserved

628Amostly conserved

631Amostly conserved

637Amostly conserved

AACTTTATATTTCATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes3

BINs3

Most divergent pair0.76%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nordstromia semililacinasame genus6.4%Nordstromia argenticepssame genus6.8%Protodeltote albidulasame order9.0%Eremochroa lunatasame order9.1%Pachyodes haematariasame order9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 389 records

Wild obs. + sensor1 136

Museum / vouchered253

Range

Area of Occupancy AOO3 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 76≤1 km 56≤10 km 12>10 km 5

149 georeferenced · 987 without coordinates

Open the mapobservation + sensor1 136

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 22≤1 km 1≤10 km 1

24 georeferenced · 229 without coordinates

Open the institutions mapphysical evidence253

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
HUNMlocation not on record	34
JP	33
Gifu prefectural Museumlocation not on record	32
NSMKlocation not on record	30
Chiba, JP	29
Kawasaki Shi Tama Ku, JP	24
KOMlocation not on record	23
Hiwa Museum of Natural Historylocation not on record	22
Iwate Prefectural Museumlocation not on record	15
Toyota city nature sanctuarylocation not on record	4
KNAMlocation not on record	2
Sagamihara, JP	2

12 institutions · 250 of 253 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Nordstromia japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.3 °C 12.3–22.2

Seasonal swing summer↔winter28.0 °C

Max temp (day)16.5 °C 16.5–25.5

Min temp (night)7.00 °C 7.00–17.7

Precipitation117 mm/mo 117–153

Air humidity58.2 % 58.2–63.1

Moisture balance33.0 mm/mo 22.1–33.0

Vapour deficit672 Pa 672–1,023

Wind speed2.30 m/s 2.30–2.40

Cloud cover39.5 % 39.5–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nordstromia japonica

At a glance

Sources7 archives

At a glance

Record type1 389 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 389 records