Nonnula frontalis

(P.L.Sclater, 1854) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Piciformes/Bucconidae/Nonnula

At a glance

Occurrence records3 791

Data sources9

Biological traits21

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Nonnula frontalis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 791 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF3 791 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

The grey-cheeked nunlet (Nonnula frontalis) is a species of near-passerine bird in the family Bucconidae, the puffbirds, nunlets, and nunbirds. It is found in Colombia and Panama.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAVONETAmnioteDBEltonTraits

Size & morphology11

Beak depth5.8 mm

Beak length (culmen)22.3 mm

Beak length (nares)16.3 mm

Beak width5.2 mm

Body mass16.35 g

Hand-wing index19.6

Kipp's distance12 mm

Secondary length49 mm

Tail length59.5 mm

Tarsus length13.1 mm

Wing length61 mm

Diet & foraging6

Ground33 %

Invertebrate100 %

Midhigh33 %

Trophic levelcarnivore

Trophic nicheInvertivore

Understory33 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size174 552 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nonnula frontalis has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTCTATCTCATTTTCGGAGCATGAGCAGGCATAATCGGCACAGCCCTCAGCCTATTAATCCGTGCAGAACTTGGCCAACCGGGCACCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nystalus maculatussame family10.0%Bucco capensissame family10.4%Monasa atrasame family10.4%Monasa morphoeussame family10.6%Malacoptila semicinctasame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 791 records

Wild obs. + sensor3 776

Museum / vouchered15

Origin

Native10

Range

Area of Occupancy AOO1 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 52≤1 km 24≤10 km 18>10 km 14

108 georeferenced · 3 668 without coordinates

Open the mapobservation + sensor3 776

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	10
Paris, FR	1
Philadelphia, US	1
Universidad Industrial de Santander (UIS)location not on record	1
Universidad del Valle (UniValle)location not on record	1
Ann Arbor, US	1

6 institutions · 15 of 15 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Nonnula frontalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 26.4–26.4

Seasonal swing summer↔winter1.70 °C

Max temp (day)29.3 °C

Min temp (night)23.4 °C

Precipitation207 mm/mo

Air humidity68.6 %

Moisture balance82.9 mm/mo

Vapour deficit1,085 Pa

Wind speed1.70 m/s

Cloud cover29.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nonnula frontalis

At a glance

Sources9 archives

Size & morphology11

Diet & foraging6

Habitat & environment4

At a glance

Record type3 791 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 791 records