Nomophila corticalis

(Walker, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Nomophila

At a glance

Occurrence records746

Data sources7

Biological traits0

DNA specimens89

eDNA detections1

Sources7 archives

Databases and archives Nomophila corticalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility746 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics89 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF746 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD89 specimens

01Narrative

Nomophila corticalis is a moth of the family Crambidae. It is known from Christmas Island and most of Australia, including the Australian Capital Territory, New South Wales, Queensland, South Australia and Victoria. The wingspan is about 20 mm. Adults have wings with variable brown splotches. The larvae have been reared on leaves of Fabaceae, Asteraceae and Polygonaceae species. Young larvae are gregarious, living in a nest of leaves joined with silk. Later instars make holes in the ground lined with silk in which to live. They emerge at night to feed.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding89 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nomophila corticalis has left across the world's sequence archives.

At a glance

DNA specimens89

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus88 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

82Cvariable

217Gmostly conserved

304Tmostly conserved

529Cvariable

619Avariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes12

BIN1

Most divergent pair0.91%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nomophila noctuellasame genus4.6%Nomophila nearcticasame genus4.9%Sameodes cancellalissame family6.7%Eurrhyparodes splendenssame family7.4%Diasemiodes eudamidasalissame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type746 records

Wild obs. + sensor641

Museum / vouchered68

Other37

Range

Area of Occupancy AOO1 496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 318≤1 km 64≤10 km 22>10 km 33

437 georeferenced · 204 without coordinates

Open the mapobservation + sensor641

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	57
Sydney, AU	3
Tallinn, EE	2
Centre for Biodiversity Genomicslocation not on record	1

4 institutions · 63 of 68 vouchered records shown · 5 without an institution code

09Environmental DNA1 detections

Where the DNA of Nomophila corticalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 23.6–23.6

Seasonal swing summer↔winter8.60 °C

Max temp (day)29.0 °C

Min temp (night)19.0 °C

Precipitation34.2 mm/mo

Air humidity61.3 %

Moisture balance-124 mm/mo

Vapour deficit1,125 Pa

Wind speed1.80 m/s

Cloud cover24.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)