Nomioides minutissimus

(Rossi, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Nomioides

At a glance

Occurrence records715

Data sources7

Biological traits1

DNA specimens13

eDNA detections10

Sources7 archives

Databases and archives Nomioides minutissimus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility715 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF715 records

Environmental DNA1 datasets · 4 countries10 detections

DNA & barcodingBOLD13 specimens

01Narrative

Dünen-Steppenbiene, Weibchen Die Dünen-Steppenbiene oder Sandsteppenbiene (Nomioides minutissimus) ist ein Hautflügler aus der Familie der Halictidae. Sie kommt als westpaläarktische, mediterran-asiatische Steppenart vor allem in den Steppen- und Wüstengebieten Zentralasiens, als Wärmezeit-Relikt aber auch in Mittel- und Südeuropa vor. Ihr Bestand ist in Deutschland stark gefährdet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)0.8 mm

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nomioides minutissimus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs6

Marker genes1

eDNA detections10

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 128 variable positions, in barcode order

1Ahighly variable

13Tmostly conserved

19Tmostly conserved

22Tvariable

37Avariable

43Tmostly conserved

44Tmostly conserved

49Avariable

50Tvariable

52Amostly conserved

55Tmostly conserved

58Amostly conserved

73Amostly conserved

76Amostly conserved

79Avariable

82Tvariable

88Tmostly conserved

91Tmostly conserved

102Amostly conserved

121Tvariable

133Avariable

139Tmostly conserved

148Amostly conserved

163Amostly conserved

172Tmostly conserved

181Tmostly conserved

184Amostly conserved

187Tmostly conserved

193Tmostly conserved

195Amostly conserved

196Tmostly conserved

206Amostly conserved

211Amostly conserved

214Tvariable

217Amostly conserved

220Tvariable

226Tmostly conserved

232Tvariable

244Amostly conserved

247Tmostly conserved

265Amostly conserved

268Amostly conserved

269Amostly conserved

274Amostly conserved

277Tmostly conserved

281Amostly conserved

284Amostly conserved

286Amostly conserved

287Amostly conserved

293Cvariable

301Avariable

303Cmostly conserved

304Tvariable

305Tvariable

316Tvariable

325Tmostly conserved

334Tmostly conserved

335Avariable

337Tmostly conserved

340Tmostly conserved

346Tmostly conserved

347Cmostly conserved

349Avariable

355Tmostly conserved

356Tmostly conserved

358Amostly conserved

360Tmostly conserved

363Amostly conserved

379Amostly conserved

386Avariable

388Amostly conserved

397Gmostly conserved

403Tmostly conserved

415Amostly conserved

418Amostly conserved

435Cmostly conserved

436Avariable

439Tmostly conserved

449Amostly conserved

454Tmostly conserved

458Tmostly conserved

461Tmostly conserved

462Cmostly conserved

472Tmostly conserved

473Gmostly conserved

479Ghighly variable

481Amostly conserved

484Amostly conserved

486Amostly conserved

490Tmostly conserved

494Avariable

502Amostly conserved

508Tmostly conserved

511Amostly conserved

519Tmostly conserved

523Tmostly conserved

526Amostly conserved

529Tmostly conserved

535Amostly conserved

536Cmostly conserved

538Tmostly conserved

541Amostly conserved

544Tvariable

547Tvariable

551Cmostly conserved

553Tvariable

556Avariable

557Tmostly conserved

559Amostly conserved

562Ahighly variable

565Amostly conserved

574Tmostly conserved

577Avariable

578Gmostly conserved

586Tmostly conserved

596Cvariable

604Avariable

607Chighly variable

620Gmostly conserved

622Cmostly conserved

+8 more variable positions not shown

AATATTATATTTTTTATTTAGTATATGAATAGGAATATTTGGTTCTTCATTAAGTTTAATTATTCGTATAGAATTAAGAGTTCCTGGTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.6%

Haplotypes3

BINs6

Most divergent pair7.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nomioides facilissame genus10.5%Nomioides maculiventrissame genus12.8%Ceylalictus variegatussame family13.5%Nomioides michenerisame genus13.7%Nomioides varigatussame genus13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type715 records

Wild obs. + sensor235

Museum / vouchered387

Other93

Origin

Native1

Range

Area of Occupancy AOO788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 28≤1 km 128≤10 km 10>10 km 8

174 georeferenced · 61 without coordinates

Open the mapobservation + sensor235

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 5≤1 km 98≤10 km 111

214 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence387

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	151
Beltsville, US	117
NMOKlocation not on record	43
Philadelphia, US	39
Provincia di Livornolocation not on record	8
ZSMlocation not on record	7
Zürich, CH	4
Bavarian State Collection of Zoologylocation not on record	3
Naturhistorisches Museum Wienlocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Coimbra, PT	1

11 institutions · 375 of 387 vouchered records shown · 12 without an institution code

09Environmental DNA10 detections

Where the DNA of Nomioides minutissimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 18.0–20.6

Seasonal swing summer↔winter21.8 °C

Max temp (day)24.9 °C 22.2–25.0

Min temp (night)15.1 °C 12.6–16.0

Precipitation93.6 mm/mo 62.3–96.6

Air humidity57.1 % 55.3–57.3

Moisture balance-49.0 mm/mo

Vapour deficit1,036 Pa 894–1,058

Wind speed2.80 m/s

Cloud cover36.6 % 33.6–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)