Nomia aurantifer

Cockerell, 1910 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Nomia

At a glance

Occurrence records32

Data sources7

Biological traits0

DNA specimens5

eDNA detections1

Sources7 archives

Databases and archives Nomia aurantifer's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF32 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD5 specimens

01Narrative

Nomia aurantifer is a species of bee in the genus Nomia, in the family Halictidae. It occurs in Australia and Southeast Asia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nomia aurantifer has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.85%

Haplotypes1

BIN1

Where individuals differ — all 12 variable positions, in barcode order

14Cmostly conserved

67Tmostly conserved

118Tmostly conserved

247Tmostly conserved

250Cmostly conserved

271Tmostly conserved

274Avariable

340Tmostly conserved

406Cmostly conserved

514Tmostly conserved

541Cmostly conserved

554Amostly conserved

AATATTATATTTTCTTTTTGCAATATGATCAGGTATATTAGGATCCTCTTTAAGAATAATTATTCGTATAGAATTAAGAATTCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lipotriches willeyisame family9.1%Lipotriches flavoviridissame family9.1%Lipotriches moerenssame family10.1%Maculonomia soekaboemiensissame family10.3%Lipotriches australicasame family10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type32 records

Wild obs. + sensor20

Museum / vouchered7

Other5

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 9≤1 km 1≤10 km 2>10 km 1

13 georeferenced · 7 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	4
Western Australian Museumlocation not on record	2
York University, Packer Collectionlocation not on record	1

3 institutions · 7 of 7 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Nomia aurantifer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 23.2–23.2

Seasonal swing summer↔winter7.30 °C

Max temp (day)27.0 °C

Min temp (night)19.7 °C

Precipitation301 mm/mo

Air humidity67.8 %

Moisture balance123 mm/mo

Vapour deficit918 Pa

Wind speed2.60 m/s

Cloud cover56.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)