Nomascus leucogenys

(Ogilby, 1840) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Primates/Hylobatidae/Nomascus

At a glance

Occurrence records38

Data sources12

Biological traits17

DNA specimens27

eDNA detections4

Sources12 archives

Databases and archives Nomascus leucogenys's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF38 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD27 specimens

Genome at a glanceGoaT · NCBI≈3.1 Gbp

01Narrative

The northern white-cheeked gibbon (Nomascus leucogenys) is a Critically Endangered species of gibbon native to South East Asia. It is closely related to the southern white-cheeked gibbon (Nomascus siki), with which it was previously considered conspecific. The females of the two species are virtually indistinguishable in appearance. The genome of N. leucogenys was sequenced and published in 2011.Ensembl entry

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAnAgeAmnioteDBEltonTraits

Size & morphology3

Body mass7 320 g

⚠ sources differ — PanTHERIA: 7 320 g · AnAge: 6 000 g · AmnioteDB: 6 621 g · EltonTraits: 7 320 g

Head body length545 mm

SVL59 cm

Life cycle & reproduction6

Age at sexual maturity3 069 days

Gestation208 days

Litter size1

Max. longevity529 months

Neonate mass497 g

Weaning age724 days

Diet & foraging3

Fruit80 %

Invertebrate10 %

Plant other10 %

Habitat & environment1

Terrestriality-999.00

Physiology & chemistry2

Precipitation mean123 mm

Temperature mean191 decidegC

Other traits2

Activity cycle3.00

Foraging stratumAr

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nomascus leucogenys has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes12

eDNA detections4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

19Cvariable

97Gmostly conserved

98Gmostly conserved

139Amostly conserved

214Cmostly conserved

307Amostly conserved

325Avariable

418Avariable

586Gvariable

622Cvariable

AACACTATACTTACTATTCGGTGCATGAGCTGGAGTCCTAGGCACAGCCCTAAGCCTCCTCATCCGAGCCGAACTGGGTCAGCCTGGCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes6

BIN1

Most divergent pair1.2%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nomascus gabriellaesame genus2.0%Symphalangus syndactylussame family9.5%Hylobates agilissame family10.6%Hylobates pileatussame family11.5%Hylobates larsame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_021957 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Nomascus leucogenys carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈3 068 802 784 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Nomascus leucogenys3.07 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness90.7% BUSCO

07Deep time~0.48 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0.48 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Environmentterrestrial

Life habitarboreal

Dietfrugivore, folivore

Motilityactively mobile

Compositionhydroxyapatite

Reproductionviviparous

08Occurrence & distribution

Record type38 records

Wild obs. + sensor35

Cultivated / captive3

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 35

35 georeferenced

Open the mapobservation + sensor35

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Nomascus leucogenys was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)