Nomadacris septemfasciata

(Serville, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Nomadacris

At a glance

Occurrence records192

Data sources7

Biological traits0

DNA specimens6

eDNA detections9

Sources7 archives

Databases and archives Nomadacris septemfasciata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility192 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF192 records

Environmental DNA2 datasets · 2 countries9 detections

DNA & barcodingBOLD6 specimens

01Narrative

The red locust (Nomadacris septemfasciata) is a large grasshopper species found in sub-Saharan Africa. Its name refers to the colour of its hind wings. It is sometimes called the criquet nomade in French, due to its nomadic movements in the dry season. When it forms swarms, it is described as a locust. Nomadacris septemfasciata is in the family Acrididae and is the only member of the genus Nomadacris. The genus Nomadacris was erected in 1923 by Boris Uvarov and the species was named originally as Acridium septemfasciatum by Jean Guillaume Audinet-Serville in 1838. It is placed in the subfamily Cyrtacanthacridinae, the bird locusts. Other species previously placed in Nomadacris are now considered part of the genus Patanga.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nomadacris septemfasciata has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P617 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.58%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 9 variable positions, in barcode order

92Cmostly conserved

184Amostly conserved

187Cmostly conserved

217Tmostly conserved

265Gmostly conserved

310Cmostly conserved

373Amostly conserved

385Tmostly conserved

613Tmostly conserved

AACCCTATACTTTATATTTGGAGCTTGAGCAGGAATAGTAGGAACATCTATAAGAATGATTATTCGTGCTGAATTAGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Willemsea bimaculatasame family7.5%Austracris guttulosasame family7.7%Valanga irregularissame family7.8%Patanga japonicasame family8.4%Cyrtacanthacris tataricasame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type192 records

Wild obs. + sensor91

Museum / vouchered101

Range

Area of Occupancy AOO456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 19≤1 km 27≤10 km 19>10 km 10

75 georeferenced · 16 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 3≤1 km 24≤10 km 2

29 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muséum d'histoire naturelle de Marseillelocation not on record	30
Cape Town, ZA	6
Durban Natural Science Museumlocation not on record	4
Helsinki, FI	1
Bonn, DE	1

5 institutions · 42 of 101 vouchered records shown · 59 without an institution code

09Environmental DNA9 detections

Where the DNA of Nomadacris septemfasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys2

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

Ricefield

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 17.7–27.2

Seasonal swing summer↔winter6.00 °C

Max temp (day)28.6 °C 22.8–33.1

Min temp (night)21.2 °C 12.2–22.0

Precipitation115 mm/mo 26.5–303

Air humidity58.4 % 56.2–69.0

Moisture balance-80.4 mm/mo -91.2–155

Vapour deficit949 Pa 839–1,575

Wind speed2.80 m/s 1.80–3.80

Cloud cover41.1 % 11.6–50.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)