Nomada vegana

Cockerell, 1903 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Nomada

At a glance

Occurrence records226

Data sources7

Biological traits0

DNA specimens8

eDNA detections2

Sources7 archives

Databases and archives Nomada vegana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility226 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF226 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD8 specimens

01Narrative

Nomada vegana is a species of nomad bee in the family Apidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nomada vegana has left across the world's sequence archives.

At a glance

DNA specimens8

BINs3

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

28Avariable

29Tmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Tvariable

35Avariable

36Tmostly conserved

37Amostly conserved

38Amostly conserved

39Tvariable

41Gvariable

43Ghighly variable

46Tvariable

73Amostly conserved

76Amostly conserved

85Amostly conserved

88Tmostly conserved

127Gvariable

181Tmostly conserved

190Amostly conserved

200Gmostly conserved

205Tvariable

241Amostly conserved

251Amostly conserved

271Amostly conserved

293Tmostly conserved

294Tmostly conserved

319Tvariable

343Tmostly conserved

356Tvariable

388Amostly conserved

391Amostly conserved

398Gvariable

409Amostly conserved

421Tvariable

436Tvariable

439Gvariable

473Gvariable

486Tvariable

562Tvariable

604Tmostly conserved

607Avariable

625Tmostly conserved

628Amostly conserved

631Amostly conserved

AATATTATATATTATTTTTGCTTTATGATCAGGTATAATTGGGACTGCAATAAGATTTATTATTCGAATAGAATTAAGAAGTCCAGGTGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes3

BINs3

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nomada lippiaesame genus2.7%Nomada gutierreziaesame genus3.0%Nomada semisuavissame genus3.1%Nomada krugiisame genus3.5%Nomada cubensissame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type226 records

Wild obs. + sensor38

Museum / vouchered188

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 17≤1 km 14≤10 km 1>10 km 5

37 georeferenced · 1 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 8≤10 km 39>10 km 8

55 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	48
Beltsville, US	41
Colorado State Universitylocation not on record	41
University of Alabamalocation not on record	26
Champaign, US	11
US	4
North Carolina State University Insect Museumlocation not on record	4
WIlocation not on record	3
CUlocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
WSUClocation not on record	2
MSUClocation not on record	1
Washington, US	1

13 institutions · 187 of 188 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Nomada vegana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 23.2–23.2

Seasonal swing summer↔winter19.0 °C

Max temp (day)29.6 °C

Min temp (night)16.7 °C

Precipitation42.4 mm/mo

Air humidity46.8 %

Moisture balance-86.7 mm/mo

Vapour deficit1,506 Pa

Wind speed2.60 m/s

Cloud cover15.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)