Nomada texana

Cresson, 1872 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Nomada

At a glance

Occurrence records824

Data sources7

Biological traits0

DNA specimens25

eDNA detections1

Sources7 archives

Databases and archives Nomada texana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility824 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF824 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD25 specimens

01Narrative

Nomada texana is a species of bee native to the southern and western United States and other parts of North America (including Mexico).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nomada texana has left across the world's sequence archives.

At a glance

DNA specimens25

BINs4

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

43Tmostly conserved

46Gmostly conserved

47Gmostly conserved

49Amostly conserved

67Amostly conserved

73Gmostly conserved

76Gmostly conserved

79Amostly conserved

81Gmostly conserved

88Amostly conserved

106Tmostly conserved

121Amostly conserved

127Amostly conserved

130Tmostly conserved

163Tmostly conserved

169Amostly conserved

181Gvariable

202Amostly conserved

205Amostly conserved

208Amostly conserved

232Amostly conserved

241Amostly conserved

268Amostly conserved

271Tmostly conserved

274Tmostly conserved

277Amostly conserved

281Tmostly conserved

294Cmostly conserved

322Tmostly conserved

325Tmostly conserved

334Tmostly conserved

346Tmostly conserved

355Amostly conserved

356Amostly conserved

358Tmostly conserved

369Amostly conserved

370Tmostly conserved

373Amostly conserved

382Amostly conserved

388Tmostly conserved

400Tmostly conserved

415Amostly conserved

421Amostly conserved

424Tmostly conserved

430Amostly conserved

433Tmostly conserved

436Amostly conserved

439Amostly conserved

460Amostly conserved

461Amostly conserved

473Amostly conserved

508Tmostly conserved

511Amostly conserved

547Tmostly conserved

553Amostly conserved

562Amostly conserved

565Amostly conserved

574Amostly conserved

592Amostly conserved

604Amostly conserved

607Tmostly conserved

625Amostly conserved

631Avariable

634Tmostly conserved

646Tmostly conserved

AATATTATATATTATTTTTGCTTTATGATCAGGAATAATTGGTACGGCAATAAGATTTATTATTCGAATAGAGTTGAGAAGTCCTGGAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes5

BINs3

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nomada fervidasame genus3.3%Nomada tiftonensissame genus3.3%Nomada cubensissame genus3.5%Nomada gutierreziaesame genus3.5%Nomada krugiisame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type824 records

Wild obs. + sensor153

Museum / vouchered671

Range

Area of Occupancy AOO1 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 74≤1 km 45≤10 km 8>10 km 7

134 georeferenced · 19 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 3≤1 km 1≤10 km 49>10 km 16

69 georeferenced · 602 without coordinates

Open the institutions mapphysical evidence671

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	468
Beltsville, US	99
Colorado State Universitylocation not on record	24
Champaign, US	17
University of Nebraska State Museumlocation not on record	17
US	9
UNHClocation not on record	6
PCYUlocation not on record	5
Cambridge, US	4
Universidad Católica de Manizaleslocation not on record	4
Lubbock, US	3
Wuzhou, CN	3
OSUClocation not on record	2
Decorah, US	1
WIlocation not on record	1
College Station, US	1
Mississippi State, US	1
Denton, US	1
München, DE	1
San Nicolás de los Garza, MX	1
US	1
North Carolina State University Insect Museumlocation not on record	1
WSUClocation not on record	1

23 institutions · 671 of 671 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Nomada texana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)