Nomada succincta

Panzer, 1798 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Nomada

At a glance

Occurrence records3 229

Data sources7

Biological traits1

DNA specimens48

eDNA detections29

Sources7 archives

Databases and archives Nomada succincta's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF3 229 records

Environmental DNA1 datasets · 9 countries29 detections

DNA & barcodingBOLD48 specimens

01Narrative

Nomada succincta is a species of bee in the family Apidae. It is known commonly as the yellow-legged nomad-bee.Wespenbienen: Nomada succincta. Wildbienen.de This species is often confused with Nomada goodeniana and the two names may be listed as synonyms. Molecular analysis confirms that they are separate species.Diestelhorst, O., & Lunau, K. (2008). Beitrag zur Klärung des Artstatus von Nomada goodeniana (Kirby, 1802) und Nomada succincta Panzer, 1798 (Hymenoptera, Apidae). Entomologie heute, 20, 165-171.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.06 mm

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nomada succincta has left across the world's sequence archives.

At a glance

DNA specimens48

BINs2

Marker genes2

eDNA detections29

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

1Tvariable

22Tmostly conserved

28Gvariable

34Avariable

59Tvariable

61Avariable

124Avariable

211Avariable

235Tmostly conserved

241Amostly conserved

319Gmostly conserved

358Amostly conserved

388Amostly conserved

415Gmostly conserved

496Tmostly conserved

554Avariable

568Tvariable

625Gvariable

TATATTATATATTATTTTTGCTTTATGGTCAGGAATAATTGGTTCATCAATAAGATTTTTAATTCGTATAGAATTAAGTAATCCAGGTGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes4

BINs2

Most divergent pair2.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nomada goodenianasame genus2.6%Nomada fucatasame genus4.9%Nomada duplexsame genus5.0%Nomada bifasciatasame genus5.2%Nomada pusillasame genus5.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type3 229 records

Wild obs. + sensor1 895

Museum / vouchered1 253

Other81

Origin

Native324

Range

Area of Occupancy AOO5 572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 423≤1 km 148≤10 km 1 012>10 km 8

1 591 georeferenced · 304 without coordinates

Open the mapobservation + sensor1 895

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 74≤1 km 125≤10 km 874>10 km 11

1 084 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence1 253

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ULglocation not on record	207
Provincia di Livornolocation not on record	107
Zürich, CH	89
Musee d'Histoire Naturallelocation not on record	56
Philadelphia, US	51
Geneva, CH	42
NMOKlocation not on record	40
Paro, BT	39
Bern, CH	38
Helsinki, FI	35
PRUNlocation not on record	31
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	30
Mons, BE	28
Muzeum Górnośląskie w Bytomiulocation not on record	25
Natural History Museum Rotterdamlocation not on record	20
Dhaka, BD	14
Coimbra, PT	13
PRAZlocation not on record	13
ZSMlocation not on record	13
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	12
Natuurpuntlocation not on record	12
Bonn, DE	12
Tilburg, NL	10
	9
IMEDEAlocation not on record	5
Centre Suisse de Cartographie de la Faunelocation not on record	5
Sion, CH	4
Ghent, BE	3
Wuzhou, CN	3
Bavarian State Collection of Zoologylocation not on record	3
Ugentlocation not on record	3
AGClocation not on record	2
Frauenfeld, CH	2
Royal British Columbia Museumlocation not on record	2
ETH Zurich, Entomological Collectionlocation not on record	2
UMUlocation not on record	2
UGRlocation not on record	1
Mykotektet, National Veterinary Institutelocation not on record	1
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record	1

39 institutions · 985 of 1 253 vouchered records shown · 268 without an institution code

09Environmental DNA29 detections

Where the DNA of Nomada succincta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map9 countries0

Mediterranean forestMaquis18City parks and large gardens

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 8.20–18.2

Seasonal swing summer↔winter17.9 °C

Max temp (day)14.6 °C 12.2–21.2

Min temp (night)5.60 °C 2.80–14.5

Precipitation47.2 mm/mo 33.5–100

Air humidity58.0 % 54.6–60.8

Moisture balance-51.2 mm/mo

Vapour deficit560 Pa 438–923

Wind speed3.90 m/s

Cloud cover40.7 % 34.9–46.6

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nomada succincta

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type3 229 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 229 records