Niltava davidi

La Touche, 1907 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Muscicapidae/Niltava

At a glance

Occurrence records1 772

Data sources8

Biological traits20

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Niltava davidi's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 772 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources20 traits

Occurrence & distributionGBIF1 772 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

The Fujian niltava (Niltava davidi) is a species of bird in the family Muscicapidae. It is found in Cambodia, China, Hong Kong, Laos, Thailand, and Vietnam. Its natural habitats are subtropical or tropical moist lowland forest and subtropical or tropical moist montane forest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAVONET

Size & morphology11

Beak depth4 mm

Beak length (culmen)15.5 mm

Beak length (nares)8.6 mm

Beak width3.9 mm

Body mass24.2 g

Hand-wing index21.9

Kipp's distance19.9 mm

Secondary length70.9 mm

Tail length68.2 mm

Tarsus length20.2 mm

Wing length90.8 mm

Diet & foraging5

Fruit50 %

Invertebrate50 %

Trophic levelomnivore

Trophic nicheOmnivore

Understory100 %

Habitat & environment4

HabitatForest

Migration3.0

Primary lifestyleInsessorial

Range size1 703 827 km²

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Niltava davidi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 548 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

66Cvariable

282Amostly conserved

GTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGCACCCTCTACTTAATCTTCGGCGCATGAGCCGGAATAGTG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_039538 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 772 records

Wild obs. + sensor1 733

Museum / vouchered39

Range

Area of Occupancy AOO1 420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 29≤1 km 32≤10 km 14>10 km 16

91 georeferenced · 1 642 without coordinates

Open the mapobservation + sensor1 733

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 8≤10 km 2

10 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	19
Cambridge, US	10
Paris, FR	7
Philadelphia, US	3

4 institutions · 39 of 39 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Niltava davidi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Niltava davidi

At a glance

Sources8 archives

Size & morphology11

Diet & foraging5

Habitat & environment4

At a glance

Record type1 772 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 772 records