Nigroporus durus — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Steccherinaceae/Nigroporus

At a glance

Occurrence records880

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Nigroporus durus's data was compiled from.

GBIFGlobal Biodiversity Information Facility880 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF880 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Nigroporus durus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Ceramides1

Documented compounds1 total

Compound	Class	Amount	Source
Cer 18:0;2O/17:0;(2OH)		present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nigroporus durus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPX957494.1 ↗491 bpMalaysia · 2025

ACGT

TCCACTTAACCCCTGTGCACTAATCCGGAGGGGTGCAGACTGGCGTGTCGGTCTATCTTGACTGGCGTTAAGGTCTGTCCTCTGGTCTCA …

Nigrohirschioporus durus voucher TNP218 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type880 records

Wild obs. + sensor838

Museum / vouchered42

Range

Area of Occupancy AOO1 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤100 m 5≤1 km 1≤10 km 830

836 georeferenced · 2 without coordinates

Open the mapobservation + sensor838

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 1≤10 km 8>10 km 6

15 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	23
Museo Entomologico de Leonlocation not on record	9
Brisbane, AU	4
TENN-Flocation not on record	2
Helsinki, FI	2
MeiseBGlocation not on record	1
DPIlocation not on record	1

7 institutions · 42 of 42 vouchered records shown