Nigronia fasciata

(Walker, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Megaloptera/Corydalidae/Nigronia

At a glance

Occurrence records712

Data sources8

Biological traits0

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Nigronia fasciata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility712 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF712 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Nigronia fasciata is a megalopterous dark fishfly in the Corydalidae family. The typical size of N. fasciata is 22 to 28 millimeters, or 2.2 to 2.8 centimeters. Range: Eastern United States. Note: not present in Canada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nigronia fasciata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)3.7%

Haplotypes1

BIN1

Where individuals differ — all 58 variable positions, in barcode order

27Cmostly conserved

29Gmostly conserved

30Gmostly conserved

32Amostly conserved

33Tmostly conserved

34Gmostly conserved

35Gmostly conserved

36Tmostly conserved

37Cmostly conserved

39Gmostly conserved

40Amostly conserved

41Amostly conserved

42Cmostly conserved

43Tmostly conserved

44Tmostly conserved

47Cmostly conserved

48Tmostly conserved

50Amostly conserved

51Gmostly conserved

52Cmostly conserved

53Tmostly conserved

54Tmostly conserved

55Amostly conserved

56Cmostly conserved

59Amostly conserved

61Cmostly conserved

62Cmostly conserved

63Gmostly conserved

64Amostly conserved

65Gmostly conserved

66Cmostly conserved

67Cmostly conserved

69Amostly conserved

70Amostly conserved

71Tmostly conserved

72Tmostly conserved

74Gmostly conserved

75Gmostly conserved

77Cmostly conserved

78Amostly conserved

81Cmostly conserved

82Tmostly conserved

83Gmostly conserved

84Gmostly conserved

85Gmostly conserved

86Tmostly conserved

87Cmostly conserved

88Amostly conserved

90Tmostly conserved

92Amostly conserved

94Tmostly conserved

95Gmostly conserved

96Gmostly conserved

97Avariable

99Amostly conserved

100Tmostly conserved

475Tmostly conserved

625Tvariable

AACTTTATATTTTCTCTTTGGTGCATCAGGAATGGTCGGAACTTCTCTTAGCTTACTAATCCGAGCCGAATTAGGACAACCTGGGTCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nigronia serricornissame genus9.9%Sinochauliodes squalidussame family13.5%Neohermes filicornissame family14.2%Neochauliodes umbratussame family14.2%Parachauliodes buchisame family14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type712 records

Wild obs. + sensor551

Museum / vouchered161

Range

Area of Occupancy AOO2 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 278≤1 km 87≤10 km 30>10 km 51

446 georeferenced · 105 without coordinates

Open the mapobservation + sensor551

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 38≤1 km 25≤10 km 18>10 km 1

82 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	72
Champaign, US	43
Lexington, US	16
Tempe, US	13
Mississippi State, US	5
Universidad Católica de Manizaleslocation not on record	5
Wuzhou, CN	3
CUlocation not on record	1
College Station, US	1
Natural History Museum of Utahlocation not on record	1
University Park, US	1

11 institutions · 161 of 161 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Nigronia fasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)