Nigetia formosalis

Walker, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Nigetia

At a glance

Occurrence records1 893

Data sources6

Biological traits0

DNA specimens20

eDNA detections20

Sources6 archives

Databases and archives Nigetia formosalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 893 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 893 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD20 specimens

01Narrative

Nigetia is a monotypic moth genus in the family Erebidae. Its only species, Nigetia formosalis, the thin-winged algibelle or thin-winged owlet moth, has a scattered distribution in eastern North America from Ontario to Connecticut, south to Florida and Texas. Both the genus and the species were first described by Francis Walker in 1866. The wingspan is about 19 mm. There is one generation in the northern parts and two or more in the southern parts of its range. Larvae have been reared on Protococcus species but probably also feed on lichens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nigetia formosalis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

1Amostly conserved

49Amostly conserved

91Tmostly conserved

92Cmostly conserved

103Tmostly conserved

157Tmostly conserved

205Tvariable

214Cvariable

217Cmostly conserved

235Cvariable

253Avariable

278Cmostly conserved

287Tvariable

313Tvariable

316Amostly conserved

343Cmostly conserved

346Tmostly conserved

385Tmostly conserved

400Tmostly conserved

412Avariable

490Cvariable

523Cvariable

532Tmostly conserved

541Gvariable

556Amostly conserved

568Tmostly conserved

631Amostly conserved

643Cvariable

652Tvariable

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTTGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes12

BINs2

Most divergent pair3.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Turuptiana obliquasame family7.6%Nocloa pallenssame order8.4%Lascoria niveasame family8.5%Trichocerapoda oceanissame order8.5%Epidesma ursulasame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 893 records

Wild obs. + sensor1 657

Museum / vouchered236

Range

Area of Occupancy AOO3 476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 894≤1 km 251≤10 km 87>10 km 134

1 366 georeferenced · 291 without coordinates

Open the mapobservation + sensor1 657

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 12≤1 km 25≤10 km 57>10 km 18

112 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	81
New Haven, US	21
CUlocation not on record	20
Milwaukee Public Museum (MPM)location not on record	18
Cambridge, US	13
ASUlocation not on record	13
East Lansing, US	11
Georgia Museum of Natural Historylocation not on record	9
King Saud Universitylocation not on record	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
UDlocation not on record	5
Philadelphia, US	4
University of Alberta Museums (UAM)location not on record	3
Cornell University Insect Collectionlocation not on record	3
San Francisco, US	1
Natural History Museum of Utahlocation not on record	1
IAWlocation not on record	1
Toronto, CA	1

18 institutions · 217 of 236 vouchered records shown · 19 without an institution code

09Environmental DNA20 detections

Where the DNA of Nigetia formosalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.3 °C 18.9–25.9

Seasonal swing summer↔winter21.9 °C

Max temp (day)27.5 °C 24.7–30.7

Min temp (night)18.4 °C 13.7–22.4

Precipitation123 mm/mo 94.4–141

Air humidity58.3 % 56.0–60.9

Moisture balance-29.8 mm/mo -76.8–19.8

Vapour deficit1,099 Pa 948–1,373

Wind speed3.30 m/s 1.50–5.10

Cloud cover36.0 % 27.4–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nigetia formosalis

At a glance

Sources6 archives

At a glance

Record type1 893 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 893 records