Nigella damascena
speciesAt a glance
Occurrence records37 622
Data sources14
Biological traits63
DNA specimens26
eDNA detections18
Sources14 archives
Databases and archives Nigella damascena's data was compiled from.
WikipediaWikimedia Foundation14 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility37 622 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources63 traits
Chemical compositionLOTUS · NPASS23 compounds
Occurrence & distributionGBIF37 622 records
Environmental DNA1 datasets · 8 countries18 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB · GoaT11.9 Gbp
01Narrative
Nigella damascena, love-in-a-mist, or devil in the bush, is an annual garden flowering plant, belonging to the buttercup family Ranunculaceae. It is native to southern Europe (but adventive in more northern countries of Europe), north Africa and southwest Asia, where it is found on neglected, damp patches of land. The specific epithet damascena relates to Damascus in Syria. The plant's common name "love-in-a-mist" comes from the flower being nestled in a ring of multifid, lacy bracts.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology20
Fruit length17.5 mm
⚠ sources differ — AusTraits: 17.5 mm · GIFT: 21.5 mm
Fruit length max20 mm
Fruit length min20 mm
Fruit width15 mm
Fruit width max20 mm
Leaf length55 mm
Leaf length max80 mm
Leaf length min30 mm
Leaf mass80.92 mg
Leaf size2 361 mm²
Plant height0.369 m
⚠ sources differ — GIFT: 0.369 m · AusTraits: 0.675 m · LEDA: 0.388 m · TRY: 0.394 m
Plant height generative0.52 m
Plant height max0.75 m
Plant height min0.15 m
Seed length2.42 mm
⚠ sources differ — TRY: 2.42 mm · GIFT: 2 mm
Seed length max2 mm
Seed length min2 mm
Seed mass2.22 mg
Seed mass max3.16 mg
Seed mass min1.06 mg
Life cycle & reproduction19
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typehuman
⚠ sources differ — LEDA: ethelochor · GIFT: unspecialized
Flower colourblue
Flower width max30 mm
Flower width min15 mm
Flowering endAug
Flowering startJun
Flowering timennnnnnnnyyyn
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number173
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 000 m
Elevation mean2 600 m
Elevation min1 000 m
Epiphyteterrestrial
Fruit typecapsule follicle
⚠ sources differ — AusTraits: capsule follicle · GIFT: capsule
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formlinear
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)170 mg/g
⚠ sources differ — TRY: 170 mg/g · LEDA: 180 mg/g
Leaf n26.13 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)29.74 mm²/mg
Other traits4
Diaspore typeseed
Plant support typefree-standing
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition23 compounds
Compounds documented for Nigella damascena across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Oleanane triterpenoids12
Flavonols2
Aminoacids1
Elemane sesquiterpenoids1
Apocarotenoids(ε-)1
Documented compounds23 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3S)-5-[[(2R,3R,4S,5R,6S)-3,4-dihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxo-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-3-yl]oxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]methoxy]-3-hydroxy-3-methyl-5-oxopentanoic acid | present | LOTUS | |
| 3-O-beta-D-glucopyranosyl(1->3)-alpha-L-rhamnopyranosyl(1->2)-alpha-L-arabinopyranosyloleanolic acid 28-O-beta-D-glucopyranosyl(1->6)-beta-D-glucopyranoside | present | LOTUS | |
| 3beta-[(O-alpha-L-rhamnopyranosyl-(1->2)-alpha-L-arabinopyranosyl)oxy] olean-12-en-28-oic acid O-beta-D-glucopyranosyl-(1->6)-beta-D-glucopyranosyl ester | present | LOTUS | |
| 7'-Hydroxy ABA | present | LOTUS | |
| [(2S)-2,3-dihydroxypropyl] 2-(2,4-dihydroxyphenyl)acetate | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (4aS,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-10-[(2S,3R,4S,5S)-3-[(2S,3R,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl] (4aS,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-10-[(2S,3R,4S,5R)-4,5-dihydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl] (4aS,6aR,6aS,6bR,8aR,9R,10S,12aS,14bS)-10-[(2S,3R,4S,5S)-4,5-dihydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-9-formyl-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl] (4aS,6aR,6aS,6bR,8aR,9S,10S,12aR,14bS)-10-[(2S,3R,4S,5S)-4,5-dihydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-9-formyl-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl] (4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2S,3R,4S,5R)-3-[(2S,3R,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate | present | LOTUS |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nigella damascena has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes6
GenBank sequences10
eDNA detections18
Countries9
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGATGCCGCTAGGCTGAGGGCACGTCTGCCTGGGCGTCACGCACA …
Nigella damascena voucher 7434HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL7★rbcLa★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Nigella damascena carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size11 912 040 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Nigella damascena11.91 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidy2× diploid · measured
Chromosome records12–142n range12median12mode81records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1280×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +15
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CAPINERI R., D'AMATO G., MARCHI P. - 1979 (1978). Numeri cromosomici per la flora italiana:534-583.. Inform. Bot. Ital. , 10(3): 421-465.
CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1981 (1980). Numeri cromosomici per la flora italiana:760-771.. Inform. Bot. Ital. , 12(2): 173-180.
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Chromosome numbers in Iberian angiosperms. Bjorkqvist, I. & al.Bot. Not.122: 271-283(1969).
CCDB · iber-fl — Contribuiao ao conhecimento cariolgico do gnero Nigella L. Pereira, A.I Congr. Nac. Ci. Nat. Lisboa.(1941).
CCDB · iber-fl — Notas cariolgicas em algumas Ranunculaceae portuguesas. Queirs, M.Collect. Bot. (Barcelona)18: 45-57(1990).
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 104-115. Queirs, M.Bol. Soc. Brot. ser. 264: 135-142(1991).
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 128-138. Queirs, M.Bol. Soc. Brot. ser. 266: 317-321(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1609
CCDB · ipcn-api-dl — Queirós, M. 1990. Notas cariológicas em algumas Ranunculaceae Portuguesas. Collect. Bot. (Barcelona) 18: 45–57.
CCDB · ipcn-api-dl — Corneanu, G. C., V. D. Simeanu, G. G. Popescu & F. Micle. 1985. Chorologic, karyologic and anatomical studies on Nigella L. genus (fam. Ranunculaceae) in Romania. Rev. Roumaine Biol., Sér. Biol. Vég. 30: 89–99.
CCDB · ipcn-api-dl — DATTA, A. K. & A. K. Biswas. 1983. Karyotype analysis in four Nigella species. Cell Chromosome Res. 6: 21–24.
CCDB · ipcn-api-dl — Queirós, M. 1991. Números cromossómicos para a flora Portuguesa. 104--105. Bol. Soc. Brot., sér. 2 64: 135–142.
CCDB · ipcn-api-dl — Baltisberger, M. & E. Baltisberger. 1995. Cytological data of Albanian plants. Candollea 50(2): 457–493.
CCDB · ipcn-api-dl — Mitra, P. K. & G. Bhowmik. 1996. Cytomorphological studies in some species of Nigella. J. Cytol. Genet. 31(2): 199–204.
CCDB · ipcn-api-dl — Okada, H. & M. TAMURA. 1979. Karyomorphology and relationship in the Ranunculaceae. J. Jap. Bot. 54: 65–77.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Capineri, R., G. D'Amato & P. Marchi. 1978. Numeri cromosomici per la Flora Italiana. 534-583. Inform. Bot. Ital. 10: 421-465.
CCDB · ipcn-api-dl — Colombo, P., C. Marceno & R. Princiotta. 1980. Numeri cromosomici per la Flora Italiana: 760-771. Inform. Bot. Ital. 12: 173–180.
CCDB · ipcn-api-dl — DATTA, A. K. & A. Saha. 2003. Cytomorphological studies and seed protein characterization of Nigella sativa L. and Nigella damascena L. Cytologia 68: 51–60.
CCDB · ipcn-api-dl — Ghosh. 2006. Karyotyping of Nigella sativa L. (black cumin) and Nigella damascena L. (love-in-a-mist) by image analyzing system. Cytologia 71(1): 1–4.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn67-71 — BJ.ORKQVIST, I . , R. VON BOTHMER, O. NILSSON: & B. NORDENSTAM. 1969. Chromosome numbers in Iberian Angiosperms. Bot. Notiser 122: 271-28;
CCDB · book-ipcn67-71 — NATARAJAN, A.T., & G. AHNSTROM. 1969. Heterochromatin and chromosome aberrations. Chromosome 28: 48-61.
CCDB · book-ipcn67-71 — 70-144
CCDB · book-ipcn67-71 — STRID, A. 1970. Studies in the Aegean flora, XVI. Biosystematics of the Niqella arvensis complex with special reference to the problem of non-adaptive radiation. Opera Botanica no. 28: 1-169. 509
CCDB · book-ipcn75-78 — Marks 1975
CCDB · book-ipcn75-78 — Popova & CeschmedJiev 1978
CCDB · book-ipcn73-74 — STRID, A. 1971. Chromosome numbers in some Albanian angiosperms. Bot. Notiser 124: 490-496.
CCDB · book-indian_vol1 — Hocquette, M. 1922 ; Langlet, O.F .J. 1927a, 1932 ; Lewitsky, G.A. (Fedo- rov); Gregory, W.C. 1941 ; Pareira, A. de L. 1942 ; Delay, C. 1947 ; Kurita, M. 1956b, 1959a; Bhatta- charyya, N.K. 1958b; Kapoor, B.M. 1966a ; Moutschen-Dahmen, J. et al. 1966 ; Bjorkqvist, I. et al. 1969 ; Natarajan, A.T. & Ahnstrom, G, 1969 ; Gilot-Delhalle, J. et al. 1976 ; Strid, A. 1970, 1971 ; Gadella, T. & Kliphuis, E. 1972 ; Moutschen, J. & Gilot-Delhalle, J. 1973 ; Marks, G.B. 1975 ; Bhandari, N.N. et al. 1976; Popova, M.T. & Cesohmedjiev, I.V. 1978 ; Van Loon, J. Chr. & Kieft, B. 1980
CCDB · book-fedorov — Hoc~ette -1922
CCDB · book-fedorov — Lang et 1927a, 1932
CCDB · book-fedorov — JleBBTCRBii: 1931B
CCDB · book-fedorov — Gregory W. C. 1941
CCDB · book-fedorov — Pereira 1942
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Kurita 1956f, 1959a
CCDB · book-fedorov — Bhattacharyya N. K. 1958b
CCDB · book-fedorov — Kapoor 1966
+37 more references
2n 141×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Subramanian, D. (1985). Cytotaxonomical studies in South Indian Ranunculaceae. Cytologia 50: 750-768.
n 610×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +2
CCDB · iber-fl — IOPB. Chromosome data 7 (ed. A. Stace). Diosdado, J. C. & al.Intern. Organ. Plant Biosyst.22: 3-4(1994).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 304-313. Pastor Daz, J., I. Fernndez & M. J. Dez.Lagascalia12(2): 281-284(1984).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 464-470. Gallego Cidoncha, M. J.Lagascalia14(2): 286-288(1986).
CCDB · ipcn-api-dl — Gallego Cidoncha, M. J. 1986. Números cromosómicos para la flora Española, 464--470. Lagascalia 14: 286–288.
CCDB · ipcn-api-dl — Diosdado, J. C., J. Vioque, R. Juan & J. Pastor. 1994. IOPB chromosome data 7. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 22: 3–4.
CCDB · book-ipcn66 — Moutschen-Dahmen et al.
CCDB · book-ipcn75-78 — Bhandari et al. 1976
CCDB · CromoCat 2015 — Diosdado, J. C., Vioque, J., Juan, R. & Pastor, J. E. (1994). IOPB Chromosome Data 7 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 22: 3-4.
CCDB · CromoCat 2015 — Gallego, M. J. (1986). Números cromosómicos para la flora española, 464-470. Lagascalia 14(2): 286-288.
CCDB · CromoCat 2015 — Pastor Diaz, J., I. Fernández & M. J. Díez. (1984). Números cromosómicos para la Flora Española, 304-313. Lagascalia 12(2): 281-283.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~5.2 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin5.2 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type37 622 records
Wild obs. + sensor34 427
Museum / vouchered3 043
Cultivated / captive11
Other141
Origin
Native760
Introduced1 315
Range
Area of Occupancy AOO87 856 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy62% within 1 km
≤100 m 13 587≤1 km 3 582≤10 km 10 008>10 km 323
27 500 georeferenced · 6 927 without coordinates
Open the mapobservation + sensor34 427
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 147≤1 km 367≤10 km 391>10 km 36
941 georeferenced · 2 102 without coordinates
Open the institutions mapphysical evidence3 043
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 7>10 km 2
9 georeferenced · 2 without coordinates
Open the mapnot free-living11
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions113 of 189 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Paris, FR | 436 |
| Berlin, DE | 423 |
| BIO-UNIPIlocation not on record | 269 |
| South Kensington, GB | 209 |
| BClocation not on record | 139 |
| LDlocation not on record | 124 |
| València, ES | 110 |
| MAlocation not on record | 75 |
| BDBClocation not on record | 73 |
| CICYTEXlocation not on record | 54 |
| Barcelona, ES | 47 |
| SLU Artdatabankenlocation not on record | 46 |
| Museo Entomologico de Leonlocation not on record | 45 |
| Moscow State Universitylocation not on record | 42 |
| MeiseBGlocation not on record | 39 |
| Granada, ES | 36 |
| Córdoba, ES | 33 |
| Provincia di Livornolocation not on record | 32 |
| Badajoz, ES | 31 |
| ISAlocation not on record | 30 |
| College of the Atlantic, Museumlocation not on record | 29 |
| Wlocation not on record | 28 |
| BFLlocation not on record | 24 |
| BRNUlocation not on record | 23 |
| UIBlocation not on record | 22 |
| Oskarshamn, SE | 21 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 19 |
| Adam Mickiewicz University in Poznańlocation not on record | 18 |
| Salamanca, ES | 16 |
| Auckland, NZ | 14 |
| Alicante, ES | 14 |
| Entomological Society of Latvialocation not on record | 13 |
| DBF-NHMDlocation not on record | 13 |
| Phyletisches Museum Jenalocation not on record | 13 |
| Madrid, ES | 12 |
| Sevilla, ES | 11 |
| GJOlocation not on record | 11 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 11 |
| Coimbra, PT | 11 |
| Bern, CH | 10 |
| Christchurch, NZ | 10 |
| Allentown, US | 9 |
| Olocation not on record | 9 |
| University of Stellenboschlocation not on record | 8 |
| Mlocation not on record | 7 |
| Bronx, US | 7 |
| Görlitz, DE | 7 |
| Chongqing Museumlocation not on record | 6 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 6 |
| CJBGlocation not on record | 6 |
| WTUlocation not on record | 6 |
| Frankfurt am Main | 5 |
| Jaén, ES | 5 |
| Denver, US | 5 |
| Mount Annan, AU | 5 |
| Corvallis, US | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Museo Achille Folettolocation not on record | 4 |
| Saint Louis, US | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Canberra, AU | 4 |
| Philadelphia, US | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Monastir, TN | 4 |
| GZUlocation not on record | 4 |
| PRClocation not on record | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Frauenfeld, CH | 3 |
| Wellington, NZ | 3 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 3 |
| Uniwersytet Warszawskilocation not on record | 3 |
| Davis, US | 3 |
| Nagano City, JP | 3 |
| Wuhan, CN | 3 |
| Bourges, FR | 3 |
| CASlocation not on record | 3 |
| Hobart, AU | 3 |
| Adelaide, AU | 3 |
| Parkville, AU | 3 |
| Uppsala, SE | 3 |
| Beijing, CN | 3 |
| Helsinki, FI | 3 |
| SZUlocation not on record | 3 |
| Porrentruy, CH | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Tilburg, NL | 3 |
| JBSlocation not on record | 3 |
| Tsukuba, JP | 3 |
| Brussel, BE | 2 |
| Claremont, US | 2 |
| Sion, CH | 2 |
| Armidale, AU | 2 |
| Ann Arbor, US | 2 |
| CZE061location not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Xian, CN | 2 |
| Université Clermont-Auvergnelocation not on record | 2 |
| Pullman, US | 2 |
| Dresden, DE | 2 |
| Santa Barbara, US | 2 |
| Yangling, CN | 2 |
| Boise, US | 2 |
| New Haven, US | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| Nanjing, CN | 2 |
| Salzburg, AT | 2 |
| Vitoria, ES | 2 |
| Baroda, IN | 2 |
| Tartu, EE | 2 |
| Burlington, US | 2 |
| Mexico City, MX | 2 |
| Pamplona, ES | 2 |
| Tampa, US | 2 |
| Trondheim, NO | 2 |
| BGR001location not on record | 1 |
| ESP109location not on record | 1 |
| IDElocation not on record | 1 |
| Logan, US | 1 |
| Wuzhou, CN | 1 |
| Xiamen, CN | 1 |
| Kingston, US | 1 |
| San Diego, US | 1 |
| Boumlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Provo, US | 1 |
| Edinburgh, GB | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| KMNlocation not on record | 1 |
| Moscow, US | 1 |
| Missoula, US | 1 |
| Nijmegen, NL | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Zhengzhou, CN | 1 |
| H-Hohlalocation not on record | 1 |
| Kew, GB | 1 |
| Zürich, CH | 1 |
| TUR-Alocation not on record | 1 |
| College Park, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Jyväskylä, FI | 1 |
| Kochi, JP | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Chicago, US | 1 |
| Porvoo, FI | 1 |
| Brookings, US | 1 |
| Tampere, FI | 1 |
| H-Dunkellocation not on record | 1 |
| San Jose, US | 1 |
| Davenport, US | 1 |
| Odawara, JP | 1 |
| Universite de Montpellierlocation not on record | 1 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 1 |
| Knoxville, US | 1 |
| Henderson, US | 1 |
| San Francisco, US | 1 |
| Oulu, FI | 1 |
| Austin, US | 1 |
| ASUlocation not on record | 1 |
| Long Beach, US | 1 |
| Universidad Católica de Santa Maríalocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Pamplona, ES | 1 |
| EEZA-CSIClocation not on record | 1 |
| Brisbane, AU | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Victoria, CA | 1 |
| Fort Worth, US | 1 |
| Winterthur, CH | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Miami, US | 1 |
| Stockholm, SE | 1 |
| Vancouver, CA | 1 |
| La Paz, BO | 1 |
| Riverside, US | 1 |
| Madrid, ES | 1 |
| St. Paul, US | 1 |
| Dekalb, US | 1 |
| Turku, FI | 1 |
| Fribourg, CH | 1 |
| SNSNMClocation not on record | 1 |
| Portland, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
189 institutions · 2 966 of 3 043 vouchered records shown · 70 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA18 detections
Where the DNA of Nigella damascena was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found18
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 18 detections have coordinates
Open the map8 countries0
Non coniferous evergreen forestsroadside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 3.90–18.8
Seasonal swing summer↔winter17.2 °C
Max temp (day)18.9 °C 6.90–23.9
Min temp (night)10.4 °C 1.10–15.1
Precipitation70.4 mm/mo 13.8–91.2
Air humidity58.3 % 45.7–67.3
Moisture balance-28.0 mm/mo -95.2–25.8
Vapour deficit804 Pa 267–859
Wind speed2.90 m/s 2.50–4.50
Cloud cover40.9 % 24.1–49.0
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.