Niditinea orleansella

(Chambers, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Niditinea

At a glance

Occurrence records75

Data sources7

Biological traits0

DNA specimens41

eDNA detections47

Sources7 archives

Databases and archives Niditinea orleansella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility75 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF75 records

Environmental DNA1 datasets · 2 countries47 detections

DNA & barcodingBOLD41 specimens

01Narrative

Niditinea orleansella is a species of clothes moth in the family Tineidae. The MONA or Hodges number for Niditinea orleansella is 0412.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Niditinea orleansella has left across the world's sequence archives.

At a glance

DNA specimens41

BINs2

Marker genes1

eDNA detections47

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

130Gmostly conserved

202Gvariable

268Amostly conserved

294Cmostly conserved

337Gmostly conserved

364Tmostly conserved

367Cmostly conserved

368Gmostly conserved

400Cmostly conserved

430Tmostly conserved

445Tmostly conserved

457Amostly conserved

487Cmostly conserved

530Gmostly conserved

535Tmostly conserved

536Cmostly conserved

550Amostly conserved

622Amostly conserved

640Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTCTTAGTTTATTAATTCGTACTGAATTAGGTAATCCAGGTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.93%

Haplotypes14

BINs2

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Niditinea sabroskyisame genus6.1%Niditinea striolellasame genus7.0%Niditinea fuscellasame genus7.6%Niditinea truncicolellasame genus8.4%Tinea subalbidellasame family10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type75 records

Wild obs. + sensor25

Museum / vouchered50

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 16≤1 km 2≤10 km 4>10 km 1

23 georeferenced · 2 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	24
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	10
University of Alberta Museums (UAM)location not on record	8
Cambridge, US	1
Research Collection of Daniel Handfieldlocation not on record	1

5 institutions · 44 of 50 vouchered records shown · 6 without an institution code

09Environmental DNA47 detections

Where the DNA of Niditinea orleansella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map2 countries0

Mixed Habitatin sugar maple-birch forestinside house

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 16.2–21.7

Seasonal swing summer↔winter31.1 °C

Max temp (day)22.8 °C 21.0–25.4

Min temp (night)14.2 °C 11.6–18.6

Precipitation117 mm/mo 95.5–127

Air humidity60.5 % 58.7–61.2

Moisture balance-17.0 mm/mo -49.8–5.40

Vapour deficit835 Pa 762–968

Wind speed2.20 m/s 2.20–4.30

Cloud cover44.8 % 32.7–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)