Nicrophorus hebes

(Kirby, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Nicrophorus

At a glance

Occurrence records1 373

Data sources4

Biological traits0

DNA specimens5

eDNA detections0

Sources4 archives

Databases and archives Nicrophorus hebes's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 373 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 373 records

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nicrophorus hebes has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTCTTTATTTTATTTTTGGAGCTTGAGCTGGAATAGTAGGAATATCACTTAGAATACTAATTCGAGTAGAACTAAGAACCCCTGGTAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nicrophorus vespilloidessame genus3.6%Nicrophorus defodienssame genus5.4%Nicrophorus investigatorsame genus10.2%Nicrophorus tomentosussame genus10.9%Nicrophorus nigritasame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 373 records

Wild obs. + sensor161

Museum / vouchered1 212

Range

Area of Occupancy AOO840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 91≤1 km 19≤10 km 6>10 km 18

134 georeferenced · 27 without coordinates

Open the mapobservation + sensor161

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 1≤10 km 3

5 georeferenced · 1 207 without coordinates

Open the institutions mapphysical evidence1 212

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	1 044
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	145
Chicago, US	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Cornell University Insect Collectionlocation not on record	3
Champaign, US	2
US	1

7 institutions · 1 210 of 1 212 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nicrophorus hebes

At a glance

Sources4 archives

At a glance

Record type1 373 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 7 geolocated

Record type1 373 records