Niceteria macrocosma

(Lower, 1899) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Niceteria

At a glance

Occurrence records412

Data sources8

Biological traits0

DNA specimens31

eDNA detections30

Sources8 archives

Databases and archives Niceteria macrocosma's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility412 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF412 records

Environmental DNA1 datasets · 1 countries30 detections

DNA & barcodingBOLD31 specimens

01Narrative

Niceteria is a monotypic moth genus in the family Geometridae erected by Alfred Jefferis Turner in 1929. Its only species, Niceteria macrocosma, the showy geometrid, is found in Australia. It was first described by Oswald Bertram Lower in 1899. The wingspan is about 40 mm. The larvae feed on Myrtaceae species, including Angophora costata.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Niceteria macrocosma has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections30

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

79Gmostly conserved

268Amostly conserved

367Cmostly conserved

451Tmostly conserved

542Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTACTAATTCGAGCAGAACTGGGGAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes7

BIN1

Most divergent pair1.5%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thalaina tetracladasame family7.5%Opisthoxia formosantesame family7.6%Planolocha iogrammasame family7.8%Parapheromia falsatasame family7.8%Gyostega simplexsame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type412 records

Wild obs. + sensor324

Museum / vouchered88

Range

Area of Occupancy AOO732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 121≤1 km 95≤10 km 16>10 km 12

244 georeferenced · 80 without coordinates

Open the mapobservation + sensor324

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 5≤1 km 4≤10 km 5

14 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	53
Tasmanian Museum & Art Gallerylocation not on record	12
ZSMlocation not on record	6
Australian National Fish Collectionlocation not on record	6
QVMAGlocation not on record	2
Tallinn, EE	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
DPIlocation not on record	1
Australian National Insect Collectionlocation not on record	1

9 institutions · 83 of 88 vouchered records shown · 5 without an institution code

09Environmental DNA30 detections

Where the DNA of Niceteria macrocosma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 14.2–20.6

Seasonal swing summer↔winter8.50 °C

Max temp (day)20.0 °C 18.2–26.2

Min temp (night)11.4 °C 10.1–15.4

Precipitation52.4 mm/mo 44.3–87.8

Air humidity56.8 % 56.6–61.8

Moisture balance-77.5 mm/mo -95.5–-40.1

Vapour deficit769 Pa 698–1,003

Wind speed4.00 m/s 2.70–4.10

Cloud cover29.9 % 22.0–36.8

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)