Nibea soldado

(Lacepède, 1802) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Sciaenidae/Nibea

At a glance

Occurrence records552

Data sources10

Biological traits9

DNA specimens36

eDNA detections8

Sources10 archives

Databases and archives Nibea soldado's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility237 records↗

OBISOcean Biodiversity Information System315 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources9 traits

Occurrence & distributionGBIF · OBIS552 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD36 specimens

01Narrative

Nibea soldado, commonly known as the soldier croaker, is a species of fish native to the northern Indian and western Pacific Oceans, and found in estuaries of south and southeast Asia, Indochina and northern Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length60 cm

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max40 m

Depth min1 m

Vulnerability49.28

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nibea soldado has left across the world's sequence archives.

At a glance

DNA specimens36

BINs4

Marker genes1

eDNA detections8

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 76% of positions are identical in every specimen.

Where individuals differ — all 154 variable positions, in barcode order

4Cmostly conserved

7Tmostly conserved

10Amostly conserved

13Tmostly conserved

16Tmostly conserved

28Cmostly conserved

31Amostly conserved

37Gmostly conserved

40Tvariable

43Amostly conserved

46Tvariable

49Gvariable

52Cmostly conserved

55Amostly conserved

58Gmostly conserved

61Cmostly conserved

64Gvariable

70Gvariable

73Gmostly conserved

85Cmostly conserved

88Cmostly conserved

91Cmostly conserved

94Tmostly conserved

100Cmostly conserved

103Cmostly conserved

107Amostly conserved

111Tmostly conserved

115Cmostly conserved

118Amostly conserved

121Cmostly conserved

124Cmostly conserved

130Cmostly conserved

136Tvariable

139Tvariable

142Gvariable

160Tmostly conserved

163Gmostly conserved

166Cmostly conserved

169Cvariable

175Cmostly conserved

178Amostly conserved

187Amostly conserved

196Cmostly conserved

199Avariable

203Cmostly conserved

208Gvariable

211Cmostly conserved

214Tvariable

217Cmostly conserved

223Tvariable

226Gmostly conserved

235Tmostly conserved

241Gmostly conserved

244Tvariable

250Amostly conserved

262Cvariable

265Tmostly conserved

268Cmostly conserved

274Cmostly conserved

280Cmostly conserved

281Cmostly conserved

283Amostly conserved

286Cmostly conserved

289Gvariable

292Cmostly conserved

295Cmostly conserved

301Amostly conserved

304Gvariable

307Amostly conserved

313Amostly conserved

316Tvariable

319Tvariable

322Cmostly conserved

325Avariable

328Amostly conserved

331Amostly conserved

334Amostly conserved

340Cmostly conserved

343Amostly conserved

350Amostly conserved

352Cmostly conserved

358Gvariable

361Cmostly conserved

364Cmostly conserved

370Gmostly conserved

379Cvariable

382Cmostly conserved

385Cvariable

394Cmostly conserved

397Cmostly conserved

400Cvariable

403Cvariable

406Tmostly conserved

412Gmostly conserved

415Cmostly conserved

418Cmostly conserved

421Cmostly conserved

424Tmostly conserved

427Amostly conserved

436Tvariable

439Cmostly conserved

442Tmostly conserved

445Tmostly conserved

451Tvariable

454Tmostly conserved

457Cmostly conserved

460Cmostly conserved

463Amostly conserved

469Cvariable

475Cmostly conserved

478Tmostly conserved

479Amostly conserved

481Amostly conserved

484Amostly conserved

487Cmostly conserved

490Gvariable

497Cvariable

502Tmostly conserved

508Amostly conserved

514Tmostly conserved

+34 more variable positions not shown

CCTCTATCTAGTTTTTGGTGCCTGAGCCGGAATAGTGGGTACAGCTCTGAGCCTACTGATCCGGGCAGAGCTGAGTCAACCCGGCTCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.4%

Haplotypes7

BINs4

Most divergent pair18.6%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nibea mitsukuriisame genus11.2%Nibea albiflorasame genus11.3%Pennahia macrocephalussame family13.5%Miichthys miiuysame family13.5%Protonibea diacanthussame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type552 records

Wild obs. + sensor70

Museum / vouchered482

Origin

Native2

Range

Area of Occupancy AOO648 km²

Depth

0–200 m sunlit53

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 45 m · 53 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 52≤1 km 1>10 km 6

59 georeferenced · 11 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 22≤1 km 119≤10 km 22>10 km 11

174 georeferenced · 308 without coordinates

Open the institutions mapphysical evidence482

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum and Art Gallery of the Northern Territorylocation not on record	51
Natick, US	33
Australian National Fish Collectionlocation not on record	32
CASlocation not on record	17
Sydney, AU	15
Ann Arbor, US	10
Paris, FR	5
	4
Mutare Museumlocation not on record	3
FishBaselocation not on record	3
Washington, US	3
Kagoshima University Museumlocation not on record	3
Louisiana State University, Museum of Zoologylocation not on record	2
Western Australian Museumlocation not on record	2
Indonesian Institute of Sciences, Research Centre for Biologylocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1

16 institutions · 185 of 482 vouchered records shown · 10 without an institution code

09Environmental DNA8 detections

Where the DNA of Nibea soldado was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

Fish market

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 21.9–26.7

Seasonal swing summer↔winter11.3 °C

Max temp (day)30.5 °C 28.5–30.6

Min temp (night)21.8 °C 15.0–22.5

Precipitation152 mm/mo 15.6–152

Air humidity60.2 % 43.4–61.3

Moisture balance25.2 mm/mo -143–25.2

Vapour deficit1,334 Pa 1,334–1,624

Wind speed1.80 m/s 1.80–4.00

Cloud cover25.6 % 18.1–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)