Nezumia namatahi

McCann & McKnight, 1980 · species

image placeholder — illustration coming later

Animalia/Chordata/Gadiformes/Macrouridae/Nezumia

At a glance

Occurrence records1 529

Data sources7

Biological traits5

DNA specimens9

eDNA detections0

Sources7 archives

Databases and archives Nezumia namatahi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility755 records↗

OBISOcean Biodiversity Information System774 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS1 529 records

DNA & barcodingBOLD9 specimens

01Narrative

The squashed face rattail, Nezumia namatahi, is a rattail of the genus Nezumia, found around New South Wales, Australia, and New Zealand, at depths of between 1,250 and 1,300 m. Its length is about 35 cm. In the month-long NORFANZ Expedition of 2003 which was examining the biodiversity of the seamounts and slopes of the Norfolk Ridge, 17 specimens averaging 110 g (0.25 lb), were collected from 10 locations.NORFANZ Voyage Retrieved 2011-10-29.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length35 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Other traits2

Depth max1 300 m

Vulnerability25

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nezumia namatahi has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

22Cmostly conserved

33Tmostly conserved

36Tmostly conserved

37Cmostly conserved

38Gmostly conserved

41Amostly conserved

42Cmostly conserved

44Gmostly conserved

45Cmostly conserved

47Tmostly conserved

49Amostly conserved

52Tmostly conserved

53Cmostly conserved

55Cmostly conserved

67Tmostly conserved

79Gmostly conserved

85Cmostly conserved

167Cmostly conserved

211Tvariable

247Tmostly conserved

268Tmostly conserved

271Amostly conserved

313Gmostly conserved

319Avariable

334Cmostly conserved

343Cmostly conserved

349Amostly conserved

400Cmostly conserved

424Tmostly conserved

445Cmostly conserved

454Cmostly conserved

472Tmostly conserved

475Tmostly conserved

481Cmostly conserved

484Amostly conserved

493Amostly conserved

496Tmostly conserved

505Tmostly conserved

532Tmostly conserved

533Cmostly conserved

553Cmostly conserved

565Cmostly conserved

589Cmostly conserved

598Cmostly conserved

619Tmostly conserved

622Tmostly conserved

637Tmostly conserved

640Gmostly conserved

643Tmostly conserved

649Tmostly conserved

CCTGTACCTTGTGTTCGGTGCCTGAGCCGGTATGGTCGGGACCGCCTTAAGTCTCTTAATTCGGGCTGAACTAGGTCAGCCCGGCTCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BINs2

Most divergent pair1.2%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nezumia wularniasame genus5.1%Nezumia convergenssame genus5.5%Nezumia liolepissame genus5.5%Nezumia latirostratasame genus5.9%Nezumia bairdiisame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 529 records

Wild obs. + sensor1 392

Museum / vouchered137

Range

Area of Occupancy AOO2 776 km²

Depth

0–200 m sunlit0

200–1000 m twilight258

1–4 km midnight455

>4 km abyssal0

median 1 050.1 m · max 1 597 m · 713 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1 356≤1 km 36

1 392 georeferenced

Open the mapobservation + sensor1 392

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 20≤1 km 40≤10 km 29>10 km 2

91 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	30
Sydney, AU	14
Museums Victorialocation not on record	9
CASlocation not on record	4
FishBaselocation not on record	1
South Kensington, GB	1

6 institutions · 59 of 137 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nezumia namatahi

At a glance

Sources7 archives

Size & morphology1

Habitat & environment2

Other traits2

At a glance

Record type1 529 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 6 geolocated

Record type1 529 records