Neverita delessertiana

(Récluz, 1843) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Naticidae/Neverita

At a glance

Occurrence records610

Data sources8

Biological traits4

DNA specimens11

eDNA detections10

Sources8 archives

Databases and archives Neverita delessertiana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility490 records↗

OBISOcean Biodiversity Information System120 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS610 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD11 specimens

01Narrative

Neverita delessertiana is a species of predatory sea snail, a marine gastropod mollusk in the family Naticidae, the moon snails. N. delessertiana was long considered to be merely a form of the much more common and much more widely distributed species Neverita duplicata. In 2006 a paper was published which made it clear that Neverita delessertiana is a different species than N. duplicata.Huelsken, T. et al. (2006) Neverita delessertiana (Recluz in Chenu, 1843): a naticid species (Gastropoda: Caenogastropoda) distinct from Neverita duplicata (Say, 1822) based on molecular data, morphological characters, and geographical distribution. Zootaxa, 1-25. PDF.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length6.75 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Depth min0 m

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neverita delessertiana has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P353 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

14Amostly conserved

119Tmostly conserved

125Gmostly conserved

269Gmostly conserved

333Cmostly conserved

ATATGGCTTTCCCACGATTAAATAATATGAGTTTTTGACTTTTACCTCCAGCTTTATTACTATTACTTTCATCTGCTGCGGTAGAAAGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes5

BIN1

Most divergent pair0.85%

OtherN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type610 records

Wild obs. + sensor351

Museum / vouchered259

Range

Area of Occupancy AOO1 104 km²

Depth

0–200 m sunlit28

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.4 m · max 29 m · 28 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 203≤1 km 48≤10 km 14>10 km 8

273 georeferenced · 78 without coordinates

Open the mapobservation + sensor351

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 1≤1 km 7≤10 km 21>10 km 4

33 georeferenced · 226 without coordinates

Open the institutions mapphysical evidence259

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	39
Chicago, US	27
Delaware Museum of Nature and Sciencelocation not on record	20
Chongqing Museumlocation not on record	4
Denver, US	1
Philadelphia, US	1
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	1
Los Angeles, US	1

8 institutions · 94 of 259 vouchered records shown · 53 without an institution code

09Environmental DNA10 detections

Where the DNA of Neverita delessertiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 14.2–14.2

Seasonal swing summer↔winter13.5 °C

Max temp (day)16.6 °C

Min temp (night)12.4 °C

Precipitation91.6 mm/mo

Air humidity60.2 %

Moisture balance-7.90 mm/mo

Vapour deficit641 Pa

Wind speed5.70 m/s

Cloud cover44.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)