Neurostrota gunniella

(Busck, 1906) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Neurostrota

At a glance

Occurrence records58

Data sources7

Biological traits0

DNA specimens16

eDNA detections18

Sources7 archives

Databases and archives Neurostrota gunniella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 5 countries18 detections

DNA & barcodingBOLD16 specimens

01Narrative

The mimosa stem-mining moth (Neurostrota gunniella) is a moth of the family Gracillariidae. It is known from Costa Rica, Cuba, Mexico and Texas, as well as Thailand and the Northern Territory in Australia,Global Taxonomic Database of Gracillariidae (Lepidoptera) where it was introduced in 1989 to control Mimosa pigra.Landry, B. 2006. The Gracillariidae (Lepidoptera, Gracillarioideae) of the Galapagos Islands, Ecuador, with notes on some of their relatives. - Revue suisse de Zoologie 113(3):437–485. (p.474 The wingspan is about 8 mm.Moth Photographers Group Adults are brown with a white stripe along the inner margin of each forewing. When in its rest position, it typically has its wings folded around the body, and its legs out.Australian Insects The larvae feed on Mimosa asperata, Mimosa pigra, Neptunia oleracea and Neptunia plena. Mimosa pigra is the main larval host plant. The larvae bore the stem of their host plant, not merely under the epidermis but actually boring into the pith of the stem.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neurostrota gunniella has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections18

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.36%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 4 variable positions, in barcode order

142Tvariable

178Avariable

367Avariable

643Cvariable

ATTATATTTTATATTTGGAATTTGAAGAGGATTAGTAGGAACATCTTTAAGTTTAATAATTCGAACAGAATTAGGTAATCCAGAACATTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neurostrota pithecolobiellasame genus2.9%Nola euraphessame order10.2%Nola pycnopastasame order10.6%Deileptenia ribeatasame order10.7%Euchaetis endoleucasame order10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type58 records

Wild obs. + sensor20

Museum / vouchered38

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 7≤1 km 3>10 km 4

14 georeferenced · 6 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
Australian National Fish Collectionlocation not on record	9
Smithsonian Institutionlocation not on record	5
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
Australian National Insect Collectionlocation not on record	2
Cambridge, US	1

6 institutions · 36 of 38 vouchered records shown · 2 without an institution code

09Environmental DNA18 detections

Where the DNA of Neurostrota gunniella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…ForestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 21.3–27.3

Seasonal swing summer↔winter2.20 °C

Max temp (day)27.6 °C 24.0–29.3

Min temp (night)22.0 °C 18.2–25.1

Precipitation217 mm/mo 19.9–394

Air humidity67.3 % 61.4–69.8

Moisture balance24.8 mm/mo -108–257

Vapour deficit1,035 Pa 849–1,322

Wind speed1.50 m/s 0.9–3.20

Cloud cover33.8 % 30.0–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)