Neuroglossum binderianum

Kütz. · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Ceramiales/Delesseriaceae/Neuroglossum

At a glance

Occurrence records162

Data sources6

Biological traits0

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Neuroglossum binderianum's data was compiled from.

GBIFGlobal Biodiversity Information Facility104 records↗

OBISOcean Biodiversity Information System58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF · OBIS162 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neuroglossum binderianum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLAF257394.1 ↗1 434 bpNamibia

ACGT

AAAAATGATCGTTATGGATCTGGAGTAATTCCGTATGCAAAAATGGGATATTGGGATCCTGACTATGTGATCAAAGAAACTGATATTTTA …

Neuroglossum binderianum from Namibia ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type162 records

Wild obs. + sensor50

Museum / vouchered104

Other8

Origin

Native2

Range

Area of Occupancy AOO224 km²

Depth

0–200 m sunlit36

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2 m · max 5.5 m · 36 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 1

6 georeferenced · 44 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 2≤1 km 45≤10 km 15>10 km 2

64 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapel Hill, US	47
MeiseBGlocation not on record	12
Department of Microbiology, Faculty of Sciencelocation not on record	9
Ann Arbor, US	8
GENTlocation not on record	8
Hobart, AU	3
Mount Annan, AU	2
Cape Town, ZA	1
GRAlocation not on record	1
Bronx, US	1
South Kensington, GB	1
Burlington, US	1

12 institutions · 94 of 104 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Neuroglossum binderianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 18.9–19.5

Seasonal swing summer↔winter13.5 °C

Max temp (day)26.6 °C 26.5–26.6

Min temp (night)12.1 °C 11.8–12.4

Precipitation32.3 mm/mo 30.5–34.0

Air humidity46.9 % 45.8–48.0

Moisture balance-108 mm/mo -115–-100

Vapour deficit1,225 Pa 1,193–1,256

Wind speed3.20 m/s 3.00–3.40

Cloud cover22.7 % 17.5–27.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)