Neurobathra strigifinitella

(Clemens, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Neurobathra

At a glance

Occurrence records461

Data sources7

Biological traits0

DNA specimens14

eDNA detections38

Sources7 archives

Databases and archives Neurobathra strigifinitella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility461 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF461 records

Environmental DNA1 datasets · 3 countries38 detections

DNA & barcodingBOLD14 specimens

01Narrative

Neurobathra strigifinitella is a moth of the family Gracillariidae. It is known from Québec, Canada, and the United States (including Pennsylvania, Florida, Georgia, Maine, Maryland, Missouri, New York, Texas, Virginia, Kentucky, and West Virginia).Global Taxonomic Database of Gracillariidae (Lepidoptera) The larvae feed on Castanea species (including Castanea dentata, Castanea pumila and Castanea sativa), Castanopsis, Fagus species (including Fagus grandifolia) and Quercus species (including Quercus nigra, Quercus prinoides, Quercus rubra and Quercus virginiana). They probably mine the leaves of their host plant. The mines may be found under the edge of a turned down leaf.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neurobathra strigifinitella has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections38

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

99Amostly conserved

213Amostly conserved

286Cmostly conserved

499Cmostly conserved

516Gmostly conserved

606Amostly conserved

624Tmostly conserved

ACTTTATATTTTATATTTGGAATTTGATCTGGTATAGTAGGTACATCTTTAAGTTTATTAATTCGAGCTGAATTGGGAAATCCTGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Patania deficienssame order9.1%Emphylica xanthocrossasame order9.6%Pleromella optersame order10.5%Gangarides flavescenssame order10.5%Syllepte phricostichasame order10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type461 records

Wild obs. + sensor417

Museum / vouchered44

Range

Area of Occupancy AOO1 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 159≤1 km 86≤10 km 18>10 km 46

309 georeferenced · 108 without coordinates

Open the mapobservation + sensor417

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 3≤10 km 5>10 km 7

15 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	14
Philadelphia, US	9
Washington, US	4
Cornell University Insect Collectionlocation not on record	4
New Haven, US	3
East Lansing, US	2
Smithsonian Institutionlocation not on record	1
CUlocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

11 institutions · 41 of 44 vouchered records shown · 3 without an institution code

09Environmental DNA38 detections

Where the DNA of Neurobathra strigifinitella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map3 countries0

1. Forest & Woodland1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…14. Artificial - Terrestrial|14.5 Urban AreasMixed deciduous and hemlock forest near smal…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 14.5–25.0

Seasonal swing summer↔winter23.2 °C

Max temp (day)26.2 °C 18.0–29.1

Min temp (night)18.4 °C 11.7–21.7

Precipitation99.7 mm/mo 5.60–126

Air humidity59.7 % 57.0–67.0

Moisture balance-54.9 mm/mo -145–-0.2

Vapour deficit916 Pa 529–1,259

Wind speed3.60 m/s 1.90–5.30

Cloud cover36.6 % 15.6–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)