Neumichtis nigerrima

(Guenée, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Neumichtis

At a glance

Occurrence records448

Data sources6

Biological traits0

DNA specimens20

eDNA detections19

Sources6 archives

Databases and archives Neumichtis nigerrima's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility448 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF448 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD20 specimens

01Narrative

Neumichtis nigerrima (the black noctuid) is a moth of the family Noctuidae. It is known from the Australian Capital Territory, New South Wales, Queensland, South Australia, Tasmania, Victoria and Western Australia. Larva Mounted The wingspan is about 40 mm. The forewings vary from dark brown to black. On the paler specimens, a pattern of light and dark brown may be discernible. The hindwings are pale with wide black borders.Australian Insects Larvae have been recorded as feeding on Saccharum, Solanum tuberosum, Beta vulgaris, Brassica rapa, Trifolium, Petrorhagia and Mentha. Young larvae are green with pale stripes. In later instars, the stripes are replaced by speckles with two bright yellow spots on the last abdominal segment.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neumichtis nigerrima has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections19

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.15%

AACATTATATTTTATTTTTGGAATTTGGGCTGGTATAGTTGGAACTTCATTAAGATTATTAATTCGGGCTGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neumichtis saliarissame genus5.0%Neumichtis spumigerasame genus5.8%Neumichtis aplectoidessame genus5.9%Eriopyga macrolepiasame family6.4%Ectopatria deloptissame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type448 records

Wild obs. + sensor335

Museum / vouchered89

Other24

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 118≤1 km 69≤10 km 37>10 km 27

251 georeferenced · 84 without coordinates

Open the mapobservation + sensor335

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 10≤1 km 2≤10 km 5>10 km 2

19 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museums Victorialocation not on record	72
Tasmanian Museum & Art Gallerylocation not on record	11
New South Wales Department of Primary Industrieslocation not on record	1

3 institutions · 84 of 89 vouchered records shown · 5 without an institution code

09Environmental DNA19 detections

Where the DNA of Neumichtis nigerrima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 11.2–20.5

Seasonal swing summer↔winter14.5 °C

Max temp (day)19.2 °C 16.9–26.3

Min temp (night)11.4 °C 6.10–14.9

Precipitation61.6 mm/mo 49.8–91.4

Air humidity57.2 % 53.2–58.6

Moisture balance-60.7 mm/mo -104–-10.3

Vapour deficit743 Pa 551–1,129

Wind speed2.50 m/s 1.60–3.90

Cloud cover21.3 % 16.9–32.7

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)