Nettastoma parviceps

Günther, 1877 · species

image placeholder — illustration coming later

Animalia/Chordata/Anguilliformes/Nettastomatidae/Nettastoma

At a glance

Occurrence records352

Data sources9

Biological traits7

DNA specimens17

eDNA detections7

Sources9 archives

Databases and archives Nettastoma parviceps's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility145 records↗

OBISOcean Biodiversity Information System207 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS352 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD17 specimens

01Narrative

The duck-billed eel (Nettastoma parviceps) also known as the shortsnouted sorcerer or the smallhead duckbill eel,Common names for Nettastoma parviceps at www.fishbase.org. is an eel in the family Nettastomatidae (duckbill/witch eels).Nettastoma parviceps at www.fishbase.org. It was described by Albert Günther in 1877.Günther, A., 1877 (1 Nov.) [ref. 2009] Preliminary notes on new fishes collected in Japan during the expedition of H. M. S. `Challenger.'. Annals and Magazine of Natural History (Series 4) v. 20 (no. 119) (art. 56): 433-446. It is a marine, deep water-dwelling eel which is known from the Indo-Pacific and the southeastern Pacific Ocean, including Japan, Hawaii, eastern Australia, southeastern Africa, and Chile. It dwells at a depth range of 60–1190 metres, and inhabits the continental shelf and slope. Males can reach a maximum total length of 82 centimetres. The species epithet "parviceps" means "little head" in Latin, and refers to the eel's head being somewhat smaller than that of Nettastoma melanura, which was the only other species in the genus known to the author. The duck-billed eel is of no commercial interest to fisheries.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length82 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max1 190 m

Depth min60 m

Vulnerability52.8

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nettastoma parviceps has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes11

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 59 variable positions, in barcode order

4Gvariable

16Tvariable

40Avariable

55Amostly conserved

61Tmostly conserved

70Gvariable

91Avariable

97Gvariable

124Tmostly conserved

163Gvariable

175Cvariable

181Avariable

193Gvariable

220Avariable

223Cvariable

229Tvariable

238Amostly conserved

259Avariable

274Gmostly conserved

277Cvariable

283Cvariable

286Gvariable

298Tvariable

301Amostly conserved

319Avariable

340Tvariable

349Avariable

376Amostly conserved

391Cvariable

404Tvariable

406Avariable

412Cvariable

415Cvariable

418Cvariable

425Tvariable

451Gvariable

460Tvariable

469Gmostly conserved

478Cvariable

481Cvariable

496Cvariable

499Gvariable

505Avariable

511Cvariable

517Avariable

520Tvariable

529Cvariable

539Tvariable

541Amostly conserved

545Tmostly conserved

562Cvariable

568Cvariable

571Avariable

577Gvariable

616Avariable

625Gvariable

628Avariable

634Gvariable

649Cmostly conserved

CTTGTATTTAGTATTTGGTGCTTGAGCCGGCATAGTCGGAACAGCCTTAAGCCTACTAATTCGGGCCGAGTTAAGTCAGCCCGGCGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes3

BINs3

Most divergent pair7.5%

OtherAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudophichthys splendenssame order14.4%Venefica procerasame family15.0%Nettastoma solitariumsame genus15.3%Gnathophis mystaxsame order15.4%Gnathophis bathytopossame order15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_013625 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND6s-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~56.2 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin56.2 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type352 records

Wild obs. + sensor205

Museum / vouchered140

Other7

Origin

Native1

Range

Area of Occupancy AOO656 km²

Depth

0–200 m sunlit40

200–1000 m twilight119

1–4 km midnight21

>4 km abyssal0

median 669.6 m · max 1 705 m · 180 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 64≤1 km 93

157 georeferenced · 48 without coordinates

Open the mapobservation + sensor205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 4≤1 km 9≤10 km 21

34 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	9
Kagoshima University Museumlocation not on record	8
Washington, US	7
FishBaselocation not on record	6
Australian National Fish Collectionlocation not on record	6
South African Institute for Aquatic Biodiversitylocation not on record	5
University of Mazandaranlocation not on record	3
Paris, FR	2
Natick, US	2
Honolulu, US	2
DEWlocation not on record	2
SCSDlocation not on record	2
Chiba, JP	1
Museums Victorialocation not on record	1
Los Angeles, US	1
Tasmanian Museum & Art Gallerylocation not on record	1
South Kensington, GB	1

17 institutions · 59 of 140 vouchered records shown · 17 without an institution code

09Environmental DNA7 detections

Where the DNA of Nettastoma parviceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 18.7–21.6

Seasonal swing summer↔winter5.10 °C

Max temp (day)20.3 °C 19.5–23.5

Min temp (night)18.4 °C 18.0–19.8

Precipitation59.1 mm/mo 58.0–121

Air humidity62.3 % 61.1–62.5

Vapour deficit843 Pa 806–1,006

Cloud cover16.0 % 15.4–32.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)