Nesticus cellulanus

(Clerck, 1757) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Nesticidae/Nesticus

At a glance

Occurrence records3 613

Data sources9

Biological traits14

DNA specimens61

eDNA detections57

Sources9 archives

Databases and archives Nesticus cellulanus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 613 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics61 specimens↗

World Spider Trait DBMasaryk University14 traits · 28 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements28 literature sources14 traits

Occurrence & distributionGBIF3 613 records

Environmental DNA1 datasets · 9 countries57 detections

DNA & barcodingBOLD61 specimens

01Narrative

Nesticus cellulanus, also known as the cavity spider or comb-footed cellar spider, is a species of scaffold web spider. It is found throughout Europe and Turkey, and has been introduced to North America.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 28 sources

Michalik & Ramirez 2014Pekár 2014aEntling et al. 2007Buchar & Růžička 2002Mammola et al. 2021Bruun & Lissner 2019Staręga et al. 2001SLU 2020Hyvärinen et al. 2019Liste France 2018Harvey et al. 2017Henriksen & Hilmo 2015Gajdoš et al. 2014Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Mammola et al. 2018Nentwig et al. 2018Cardoso et al. 2011Shao et al. 2023

Morphometry1

Body length♀4.75·♂4.1 mm

Predation3

Hunting guildspace web weavers

Hunting guild 2aerial web builder

Web buildingyes

Ecology8

Light0.375 mm

Light 2shaded

MicrohabitatMilieu Souterrain Superficiel (MSS)

Moisture 10.75 mm

Moisture 2very humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categorySave or at low risk (SA)

Subterranean affinityTroglophile

Anatomy1

Sperm transfer formcleistospermia

Defence1

Retreatstone, cellar

05DNA & barcoding61 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nesticus cellulanus has left across the world's sequence archives.

At a glance

DNA specimens61

BINs2

Marker genes3

eDNA detections57

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

106Cvariable

110Tmostly conserved

271Cmostly conserved

343Tmostly conserved

616Tvariable

632Gmostly conserved

646Cmostly conserved

655Gmostly conserved

GACGTTATATTTTATTTTTGGATCTTGAGCTGCTATAGTTGGTACAGGGATGAGATTATTGATTCGAACTGAGTTAGGACAAGTTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes12

BIN1

Most divergent pair12.0%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Kryptonesticus arenstorffisame family11.9%Kryptonesticus dimensissame family12.2%Kryptonesticus deelemanaesame family12.5%Grammonota texanasame order14.5%Collinsia holmgrenisame order14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type3 613 records

Wild obs. + sensor3 010

Museum / vouchered504

Other99

Origin

Native50

Range

Area of Occupancy AOO7 680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 690≤1 km 266≤10 km 1 031>10 km 38

2 025 georeferenced · 985 without coordinates

Open the mapobservation + sensor3 010

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 14≤1 km 34≤10 km 209>10 km 8

265 georeferenced · 239 without coordinates

Open the institutions mapphysical evidence504

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	100
Bonn, DE	55
Bern, CH	39
Helsinki, FI	32
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	29
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	10
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	9
Frankfurt am Main	8
SLU Artdatabankenlocation not on record	8
	7
Tartu, EE	4
Tilburg, NL	4
Adam Mickiewicz University in Poznańlocation not on record	3
Copenhagen, DK	3
Washington, US	3
ARTlocation not on record	2
Royal Ontario Museumlocation not on record	2
Cambridge, US	2
Paro, BT	2
Buenos Aires, AR	1
Research Collection of Niclas Fritzenlocation not on record	1
Uniwersytet w Białymstokulocation not on record	1
Ekaterinburg, RU	1
Ghent, BE	1
BioFokuslocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
FETSlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
neflocation not on record	1

30 institutions · 333 of 504 vouchered records shown · 171 without an institution code

09Environmental DNA57 detections

Where the DNA of Nesticus cellulanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map9 countries0

5-10 m vom Eingang entfernt15-20 m vom Eingang entfernt10-15 m vom Eingang entfernt2-5 m vom Eingang entferntWasseruhr-Schacht115-120 m vom Eingang entfernt

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.80 °C 6.00–18.4

Seasonal swing summer↔winter18.1 °C

Max temp (day)13.4 °C 9.40–21.8

Min temp (night)5.90 °C 1.50–16.4

Precipitation79.4 mm/mo 48.2–112

Air humidity63.2 % 56.1–67.1

Moisture balance5.00 mm/mo -39.0–34.9

Vapour deficit503 Pa 350–845

Wind speed3.10 m/s 2.30–5.20

Cloud cover43.3 % 35.4–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nesticus cellulanus

At a glance

Sources9 archives

Morphometry1

Predation3

Ecology8

Anatomy1

Defence1

At a glance

Record type3 613 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 613 records