Nesticodes rufipes

(Lucas, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theridiidae/Nesticodes

At a glance

Occurrence records3 439

Data sources9

Biological traits5

DNA specimens136

eDNA detections148

Sources9 archives

Databases and archives Nesticodes rufipes's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 439 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI148 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics136 specimens↗

World Spider Trait DBMasaryk University5 traits · 5 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources5 traits

Occurrence & distributionGBIF3 439 records

Environmental DNA1 datasets · 12 countries148 detections

DNA & barcodingBOLD136 specimens

01Narrative

Nesticodes is a monotypic genus of comb-footed spiders containing only the red house spider [Nesticodes rufipes (Lucas, 1846)]. It was first described by Allan Frost Archer in 1950, and has a pantropical distribution due to ship and air travel.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesMichalik & Ramirez 2014Řezáč et al. 2015Nentwig et al. 2018Cardoso et al. 2011Pekár et al. 2012a

Morphometry1

Body length♀5·♂3.5 mm

Predation2

Hunting guildspace web weavers

Prey diversity3 mm

Ecology1

Regional non-IUCN Red List categoryEcologically Sustainable (ES)

Anatomy1

Sperm transfer formcleistospermia

05DNA & barcoding136 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nesticodes rufipes has left across the world's sequence archives.

At a glance

DNA specimens136

BINs1

Marker genes2

eDNA detections148

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus133 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

390Cmostly conserved

532Avariable

601Tmostly conserved

AACTTTATATTTAGTATTTGGGGCTTGAGCTGCTATAGTTGGTACTGCAATAAGAGTATTAATTCGAATTGAATTAGGACAAACTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes15

BIN1

Most divergent pair0.76%

N.AmericaS.AmericaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thymoites maderaesame family7.0%Theridion ravumsame family7.4%Achaearanea maricaoensissame family7.6%Theridion glaucescenssame family7.9%Theridion michenerisame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type3 439 records

Wild obs. + sensor3 344

Museum / vouchered95

Range

Area of Occupancy AOO8 216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 1 521≤1 km 523≤10 km 313>10 km 301

2 658 georeferenced · 686 without coordinates

Open the mapobservation + sensor3 344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 2≤1 km 6≤10 km 3

11 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	23
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	9
Frankfurt am Main	8
Chicago, US	8
Centre for Biodiversity Genomicslocation not on record	7
Laboratoire Biométrie et Biologie Evolutive, University Lyon 1location not on record	3
Museu Paraense Emílio Goeldilocation not on record	2
Royal Museum for Central Africalocation not on record	2
QVMAGlocation not on record	2
Buenos Aires, AR	1
Tartu, EE	1
PUC-RSlocation not on record	1
Universite Claude Bernard Lyon 1location not on record	1
Sydney, AU	1

14 institutions · 69 of 95 vouchered records shown · 26 without an institution code

09Environmental DNA148 detections

Where the DNA of Nesticodes rufipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found148

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 148 detections have coordinates

Open the map12 countries0

Forest1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.9. Subtropical/Tropic…1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 12.4–27.2

Seasonal swing summer↔winter3.10 °C

Max temp (day)25.6 °C 16.1–30.4

Min temp (night)20.0 °C 8.60–24.6

Precipitation117 mm/mo 3.10–502

Air humidity64.2 % 56.7–73.2

Moisture balance33.5 mm/mo

Vapour deficit877 Pa 399–1,553

Wind speed2.20 m/s

Cloud cover33.7 % 21.1–66.2

CHELSA 1981–2010, ~9 km grid, at location & month of 85 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nesticodes rufipes

At a glance

Sources9 archives

Morphometry1

Predation2

Ecology1

Anatomy1

At a glance

Record type3 439 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 439 records