Nessaea aglaura

(Doubleday) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Nessaea

At a glance

Occurrence records162

Data sources7

Biological traits0

DNA specimens40

eDNA detections39

Sources7 archives

Databases and archives Nessaea aglaura's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility162 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF162 records

Environmental DNA1 datasets · 2 countries39 detections

DNA & barcodingBOLD40 specimens

01Narrative

Nessaea aglaura, the common olivewing,Glassberg, J. (2007) A Swift Guide to the Butterflies of Mexico and Central America. Sunstreak Books, p.107. northern nessaea or Aglaura olivewing, is a species of butterfly of the family Nymphalidae. It is found from Mexico to Panama, Ecuador, Venezuela and Colombia. It is found in evergreen tropical forest and in semi-deciduous tropical forest.Neotropical Nymphalidae VII. Revision of Nessaea The length of the wings is 31–34 mm for males and 28–36 mm for females. Adults are on wing nearly year round. They are notable for the presence of blue pigments in their wings, as opposed to blue created by physical structures. The larvae feed on Alchornea costaricensis and Plukenetia volubilis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nessaea aglaura has left across the world's sequence archives.

At a glance

DNA specimens40

BINs1

Marker genes1

eDNA detections39

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

266Cmostly conserved

376Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGACTAATTGGAACTTCTCTTAGATTATTAATTCGAACAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nessaea batesiisame genus5.2%Catonephele oritessame family7.9%Vanessa gonerillasame family8.0%Catonephele numiliasame family8.5%Catonephele acontiussame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type162 records

Wild obs. + sensor126

Museum / vouchered36

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 39≤1 km 43≤10 km 22>10 km 11

115 georeferenced · 11 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 4≤1 km 2≤10 km 1>10 km 6

13 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tapachula, MX	6
New Haven, US	5
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	3
Cambridge, US	2
Universidad Nacional de Colombia (UNAL)location not on record	2
Uniwersytet Jagiellońskilocation not on record	1
Universidad Tecnológica del Chocó (UTCH)location not on record	1
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1
South Kensington, GB	1
Brussels, BE	1
Auckland, NZ	1

11 institutions · 24 of 36 vouchered records shown · 12 without an institution code

09Environmental DNA39 detections

Where the DNA of Nessaea aglaura was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 23.7–26.6

Seasonal swing summer↔winter2.30 °C

Max temp (day)28.2 °C 26.1–31.5

Min temp (night)21.9 °C 21.0–23.3

Precipitation243 mm/mo 67.4–474

Air humidity67.3 % 63.6–75.7

Moisture balance121 mm/mo -48.7–350

Vapour deficit988 Pa 707–1,236

Wind speed1.50 m/s 1.00–2.50

Cloud cover30.8 % 16.8–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)