Nephrops norvegicus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Nephropidae/Nephrops

At a glance

Occurrence records70 496

Data sources14

Biological traits7

DNA specimens83

eDNA detections74

Sources14 archives

Databases and archives Nephrops norvegicus's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 943 records↗

OBISOcean Biodiversity Information System63 553 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI74 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics83 specimens↗

FooDBThe Metabolomics Innovation Centrecompounds↗

foodatlascompounds

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~4.79 Gbp↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Chemical compositionFooDB · FoodAtlas · NPASS96 compounds

Occurrence & distributionGBIF · OBIS70 496 records

Environmental DNA3 datasets · 8 countries74 detections

DNA & barcodingBOLD83 specimens

Genome at a glanceGoaT4.8 Gbp

01Narrative

Nephrops norvegicus, known variously as the Norway lobster, Dublin Bay prawn, (compare langostino) or scampi, is a slim, orange-pink lobster which grows up to 25 cm long, and is "the most important commercial crustacean in Europe". It is now the only extant species in the genus Nephrops, after several other species were moved to the closely related genus Metanephrops. It lives in the north-eastern Atlantic Ocean, and parts of the Mediterranean Sea, but is absent from the Baltic Sea and Black Sea. Adults emerge from their burrows at night to feed on worms and fish.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length24 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max800 m

Depth min20 m

Vulnerability14

03Chemical composition96 compounds

Compounds documented for Nephrops norvegicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingAquatic foods

Compound class profile5 classes

Aminoacids43

Unsaturated fatty acids27

Branched fatty acids $ Unsaturated fatty acids14

Pyridine alkaloids10

Prenyl quinone meroterpenoids6

Documented compounds96 total

Tissue Source Quantified only

Compound	Amount	Source
Cholesterol	95,000 mg/100 g	FooDB
Nitrogen	3,100 mg/100 g	FooDB
(E)-2-Phenyl-2-butenal	3,100 mg/100 g	FooDB
L-Glutamic acid	3,100 mg/100g	FooDB
L-Aspartic acid	2,100 mg/100g	FooDB
D-Aspartic acid	2,100 mg/100 g	FooDB
L-Leucine	1,700 mg/100g	FooDB
Arginine	1,600 mg/100g	FooDB

05DNA & barcoding83 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nephrops norvegicus has left across the world's sequence archives.

At a glance

DNA specimens83

BINs1

Marker genes11

eDNA detections74

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus65 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

18Avariable

21Tvariable

51Avariable

69Gvariable

123Gmostly conserved

252Gvariable

261Cmostly conserved

297Amostly conserved

339Thighly variable

466Avariable

467Gvariable

654Tvariable

CTATATTTTATCTTCGGAGCTTGAGCAGGCATAGTAGGGACTTCATTAAGATTGGTAATTCGTGCTGAGTTAGGTCAACCAGGAAGTCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.98%

Haplotypes16

BIN1

Most divergent pair2.4%

AsiaEuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Homarus americanussame family11.6%Homarus gammarussame family12.5%Melanostoma polynesiotessame order17.2%Celyphus signatussame order17.3%Scatella obsoletasame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIIND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_025958 ↗ · 13 protein · 21 tRNA · 2 rRNA

COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1ND2rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Nephrops norvegicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 792 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Nephrops norvegicus4.79 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

07Deep time~81.3 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin81.3 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

How it livedPBDB

Life habitinfaunal

Dietcarnivore

Motilityactively mobile

Visionwell-developed

Compositionchitin

08Occurrence & distribution

Record type70 496 records

Wild obs. + sensor5 648

Museum / vouchered3 174

Other61 674

Origin

Native2

Range

Area of Occupancy AOO23 256 km²

Depth

0–200 m sunlit52 397

200–1000 m twilight7 740

1–4 km midnight0

>4 km abyssal0

median 58.9 m · max 822.5 m · 60 137 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 3 150≤1 km 717≤10 km 169>10 km 22

4 058 georeferenced · 1 590 without coordinates

Open the mapobservation + sensor5 648

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 63≤1 km 51≤10 km 50>10 km 332

496 georeferenced · 2 678 without coordinates

Open the institutions mapphysical evidence3 174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICATMARlocation not on record	478
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	395
Frankfurt am Main	83
RWSlocation not on record	68
730location not on record	47
CEFASlocation not on record	47
DASSHlocation not on record	46
IPMAlocation not on record	41
Gothenburg, SE	35
SLU Artdatabankenlocation not on record	25
Brussels, BE	23
ICM-CSIClocation not on record	18
ICESlocation not on record	18
University of Oslo (UiO)location not on record	16
Washington, US	15
AUTHlocation not on record	15
NTNU-VMlocation not on record	9
Natural History Museum Rotterdamlocation not on record	8
Norwegian Institute of Marine Researchlocation not on record	7
Tromsø, NO	5
Bergen, NO	5
RBINS-Scientific Heritagelocation not on record	5
South Kensington, GB	5
Biomorlocation not on record	4
IEO-COMA-CSIClocation not on record	3
IEOlocation not on record	3
Helsinki, FI	3
Museum für Naturkunde Berlin (Zoological Collections)location not on record	3
MZLUlocation not on record	3
Museu Nacional de História Natural e da Ciêncialocation not on record	3
Cambridge, US	3
	2
Zoologisches Museum der Universitaet Kiellocation not on record	2
WoRMS Editorial Boardlocation not on record	1
Stockholm, SE	1
BioFokuslocation not on record	1
Zoologisches Museum Hamburglocation not on record	1
Naturalis Biodiversity Centerlocation not on record	1
Stockholm, SE	1
Chicago, US	1
PNHSlocation not on record	1

41 institutions · 1 451 of 3 174 vouchered records shown · 77 without an institution code

09Environmental DNA74 detections

Where the DNA of Nephrops norvegicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found74

Studies independent surveys3

Countries8

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 74 detections have coordinates

Open the map8 countries0

Mixed soft bottom

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 6.40–16.8

Seasonal swing summer↔winter15.6 °C

Max temp (day)15.7 °C 7.40–17.8

Min temp (night)5.40 °C 3.20–15.8

Precipitation47.7 mm/mo 42.3–106

Air humidity61.1 % 54.3–64.8

Moisture balance15.9 mm/mo

Vapour deficit708 Pa 358–733

Wind speed6.00 m/s

Cloud cover42.7 % 34.3–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nephrops norvegicus

At a glance

Sources14 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

Compound class profile5 classes

Documented compounds96 total

At a glance

Genome sizehow big the whole instruction manual is

At a glance

When this lineage existed

How it livedPBDB

Record type70 496 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 41 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type70 496 records