Nephelium lappaceum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Nephelium

At a glance

Occurrence records1 033

Data sources15

Biological traits51

DNA specimens18

eDNA detections11

Sources15 archives

Databases and archives Nephelium lappaceum's data was compiled from.

WikipediaWikimedia Foundation20 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 033 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

FooDBThe Metabolomics Innovation Centrecompounds↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources51 traits

Chemical compositionFooDB · LOTUS · NPASS5 593 compounds

Occurrence & distributionGBIF1 033 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD · NCBI18 specimens

Genome at a glanceCCDB · GoaT · NCBI≈409 Mbp

01Narrative

Nephelium chryseum is a species of plant related to the rambutan. The plant produces edible fruit that are covered in hard red shells with spikey spines. It is native to southern China, Borneo, the Philippines, and Vietnam.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit width35 mm

Fruit width max40 mm

Fruit width min30 mm

Leaf length123 mm

Leaf size12 250 mm²

Leaf width44 mm

Plant height15 m

⚠ sources differ — GIFT: 15 m · TRY: 20 m

Plant height max30 m

Seed length25.2 mm

Seed mass1 920 mg

Seed mass max3 355 mg

Seed mass min230 mg

Seed volume2 900 mm³

Seed volume max2 900 mm³

Seed volume min2 900 mm³

Seed width max14.7 mm

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 500 m

Elevation mean1 000 m

Elevation min500 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Habitat GIFTÁrea Antrópica

Leaf formelliptic

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry8

Leaf c526 mg/g

Leaf dry-matter content (LDMC)499 mg/g

Leaf n17.81 mg/g

Leaf p1.8 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10 mm²/mg

⚠ sources differ — TRY: 10 mm²/mg · GIFT: 18.04 mm²/mg

Wood density724 mg/cm³

Other traits7

Leaf marginentire

Leaf spinesno

Leaf thickness0.018 mm

Leaf thornsno

Seed height max8.8 mm

Sla max18.04 mm²/mg

Sla min18.04 mm²/mg

03Chemical composition5 593 compounds

Compounds documented for Nephelium lappaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingFruits

Compound class profile5 classes

Aminoacids67

Glycerophospholipids57

Cinnamic acids and derivatives30

Purine nucleos(t)ides26

Monosaccharides25

Documented compounds5 593 total

Tissue Source Quantified only

Compound	Amount	Source
Potassium	42 mg/100g	FooDB
Calcium	22 mg/100g	FooDB
Sodium	11 mg/100g	FooDB
Phosphorus	9 mg/100g	FooDB
Folic acid	8 mg/100g	FooDB
L-Ascorbic acid	4.9 mg/100g	FooDB
Retinol	3 IU	FooDB
Nicotinic acid	1.352 mg/100g	FooDB
Iron	0.35 mg/100g	FooDB
Manganese	0.343 mg/100g	FooDB

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nephelium lappaceum has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes6

GenBank sequences10

eDNA detections11

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOK052925.1 ↗475 bpMalaysia · 2019

ACGT

TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGTGTC …

Nephelium lappaceum voucher A4481 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK★rbcL5★ITS5★ITS2trnH-psbA

animal barcodeplant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Nephelium lappaceum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈409 258 346 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Nephelium lappaceum0.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Ramirez, D.A. 1961

n 111×CCDB · Cave1962

CCDB · Cave1962 — Ramirez 1961a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.984 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.6% BUSCO

08Occurrence & distribution

Record type1 033 records

Wild obs. + sensor475

Museum / vouchered246

Cultivated / captive311

Other1

Origin

Introduced6

Range

Area of Occupancy AOO1 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 215≤1 km 58≤10 km 35>10 km 42

350 georeferenced · 125 without coordinates

Open the mapobservation + sensor475

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 37≤1 km 2≤10 km 9>10 km 5

53 georeferenced · 193 without coordinates

Open the institutions mapphysical evidence246

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 105

110 georeferenced · 201 without coordinates

Open the mapnot free-living311

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 50 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapingo, MX	26
Saint Louis, US	10
University of Stellenboschlocation not on record	7
Smithfield, AU	6
Universidad Juárez Autónoma de Tabascolocation not on record	6
Bronx, US	6
Xiamen, CN	5
Cibinong Science Center, Herbarium Bogorienselocation not on record	5
MeiseBGlocation not on record	5
Kew, GB	5
Salvador, BR	4
James Cook Townsvillelocation not on record	4
Antiguo Cuscatlán, SV	3
National Biodiversity Institute, Costa Ricalocation not on record	3
Guangxi Agricultural Universitylocation not on record	3
San José, CR	3
UFBAlocation not on record	3
JBRJlocation not on record	2
Guangzhou, CN	2
University of Hamburglocation not on record	2
Taipei, TW	2
ASUlocation not on record	2
Hobart, AU	2
Taipei, TW	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Brisbane, AU	2
Forest Herbarium Ibadan (FHI)location not on record	1
Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record	1
Mexico City, MX	1
EL PASO, US	1
Auckland, NZ	1
Guilin, CN	1
UFRRJlocation not on record	1
Berlin, DE	1
arosemena tola, EC	1
Cincinnati, US	1
Herbarium of South China Botanical Gardenlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
Honolulu, US	1
Philadelphia, US	1
Fort Worth, US	1
Wuhan, CN	1
St. Augustine, TT	1
Istituto Agrario Castelnuovolocation not on record	1
Seropédica, BR	1
Canberra, AU	1
SCAUlocation not on record	1
Gump Stationlocation not on record	1
Tapachula, MX	1

50 institutions · 146 of 246 vouchered records shown · 99 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Nephelium lappaceum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 12.6–25.8

Seasonal swing summer↔winter15.4 °C

Max temp (day)25.7 °C 17.7–28.3

Min temp (night)18.7 °C 6.20–23.4

Precipitation157 mm/mo 42.5–324

Air humidity63.0 % 49.1–68.5

Moisture balance48.2 mm/mo -66.5–193

Vapour deficit1,036 Pa 869–1,041

Wind speed2.40 m/s 1.20–4.10

Cloud cover45.8 % 28.5–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nephelium lappaceum

At a glance

Sources15 archives

Size & morphology16

Life cycle & reproduction6

Diet & foraging1

Habitat & environment13

Physiology & chemistry8

Other traits7

Compound class profile5 classes

Documented compounds5 593 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 033 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions29 of 50 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Documented compounds5 593 total

Record type1 033 records