Nepeta cataria
speciesAt a glance
Occurrence records35 117
Data sources17
Biological traits55
DNA specimens34
eDNA detections21
Sources17 archives
Databases and archives Nepeta cataria's data was compiled from.
WikipediaWikimedia Foundation17 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility35 117 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics34 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources55 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS193 compounds
Occurrence & distributionGBIF35 117 records
Environmental DNA1 datasets · 5 countries21 detections
DNA & barcodingBOLD · NCBI34 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex636 Mbp
01Narrative
Nepeta cataria, commonly known as catnip, catswort, catwort, and catmint, is a species of the genus Nepeta in the family Lamiaceae, native to southern and eastern Europe, the Middle East, Central Asia, and parts of China. It is widely naturalized in northern Europe, New Zealand, and North America.World Checklist of Selected Plant Families: Royal Botanic Gardens, KewFlora of China Vol. 17 Page 107 荆芥属 jing jie shu Nepeta Linnaeus, Sp. Pl. 2: 570. 1753.Altervista Flora Italiana, genere Nepeta includes photos plus range maps for Europe and North America The common name catmint can also refer to the genus as a whole. The names catnip and catmint are derived from the intense attraction about two-thirds of cats have toward it (alternative plants exist). In addition to its uses with cats, catnip is an ingredient in some herbal teas (or tisanes), and is valued for its sedative and relaxant properties.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology20
Fruit length2.25 mm
Leaf length42.5 mm
Leaf length max50 mm
Leaf mass13.13 mg
Leaf size1 125 mm²
⚠ sources differ — TRY: 1 125 mm² · LEDA: 390 mm² · GIFT: 390 mm²
Leaf width25 mm
⚠ sources differ — AusTraits: 25 mm · GIFT: 35 mm
Leaf width max35 mm
Leaf width min35 mm
Petiole length1.5 cm
Plant height0.567 m
⚠ sources differ — GIFT: 0.567 m · AusTraits: 0.8 m · LEDA: 0.6 m · TRY: 0.694 m
Plant height generative0.7 m
Plant height max1.5 m
Plant height min0.4 m
Seed length1.5 mm
Seed mass0.546 mg
⚠ sources differ — TRY: 0.546 mg · LEDA: 0.58 mg · GIFT: 0.565 mg
Seed mass max0.58 mg
Seed mass min0.5 mg
Seed volume0.48 mm³
Seed volume max0.48 mm³
Seed volume min0.48 mm³
Life cycle & reproduction14
Deciduousnessevergreen
Dispersal typehuman
⚠ sources differ — LEDA: ethelochor · GIFT: unspecialized
Flowering endSep
Flowering startJun
Flowering timeynnnnnnnnnnn
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: perennial · LEDA: poly-annuals < 5 years (short-lived perennials) · GIFT: perennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number236
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 700 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typemericarp
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf shapeovate triangular
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf c395 mg/g
Leaf dry-matter content (LDMC)365 mg/g
⚠ sources differ — TRY: 365 mg/g · LEDA: 190 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)14.62 mm²/mg
⚠ sources differ — TRY: 14.62 mm²/mg · LEDA: 30.9 mm²/mg · GIFT: 30.9 mm²/mg
Other traits1
Diaspore typemericarp
03Chemical composition193 compounds
Compounds documented for Nepeta cataria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking🌿 Tea
Compound class profile5 classes
Iridoids monoterpenoids21
Flavones15
Labdane diterpenoids5
Branched fatty acids $ Unsaturated fatty acids4
Cinnamic acids and derivatives4
Documented compounds193 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| NEPETALACTONE | 999,000 ppm | DukesPhytochem | |
| WATER | 880,000 ppm | DukesPhytochem | |
| LINOLENIC-ACID | 570,000 ppm | DukesPhytochem | |
| EPINEPETALACTONE | 400,000 ppm | DukesPhytochem | |
| NEROL | 276,000 ppm | DukesPhytochem | |
| GERANIOL | 255,000 ppm | DukesPhytochem | |
| FAT | 212,000 ppm | DukesPhytochem | |
| PROTEIN | 184,000 ppm | DukesPhytochem | |
| LINOLEIC-ACID | 180,000 ppm | DukesPhytochem | |
| CITRONELLOL | 126,000 ppm | DukesPhytochem |
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nepeta cataria has left across the world's sequence archives.
At a glance
DNA specimens34
Marker genes6
GenBank sequences10
eDNA detections21
Countries6
The DNA barcodea real sequence read deposited for this species
CGCCGCCCGCGACGTCGTGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGG …
Nepeta cataria voucher L. Jiang s.n. from USA small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★ITS2★ITS2atpF-atpH
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Nepeta cataria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size635 700 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Nepeta cataria0.64 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 34 n = 17
Ploidypolyploid inferred
Chromosome records18–362n range34median34mode48records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3420×CCDB · slov-fl · CCDB · iapt · CCDB · brit-fl +7
CCDB · slov-fl — Kochjarová J., 1992: Karyological study of the Slovak flora XXVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 67-74.
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · brit-fl — Morton, J.K. Watsonia 9: 239-246 (1973)
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Nepeta L. en la pennsula Ibrica. Ubera, J. L.Lagascalia11(1): 71-80(1983).
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Buttler, K. P. 1984. Chromosomenzahlen von Gefässpflanzen aus Hessen (und dem angrenzenden Bayern), 2. Folge. Hess. Florist. Briefe 33: 46–48.
CCDB · ipcn-api-dl — Gill, L. S. 1981. Chromosomal evolution and incidence of polyploidy in the Canadian Labiatae. Rev. Cytol. Biol. Vég., Bot. 4: 331–339.
CCDB · ipcn-api-dl — Budantsev, A. L., E. A. Zemskova & T. G. Semicheva. 1992. Chromosome numbers in genera of the tribe Nepeteae (Lamiaceae) and some problems of their systematics. Bot. Žhurn. (Moscow & Leningrad) 77(2): 13–24.
CCDB · ipcn-api-dl — LEE, Y. N. 1967. Chromosome numbers of flowering plants in Korea. J. Korean Res. Inst. Ewha Women's Univ. 11: 455–478.
CCDB · ipcn-api-dl — Murin, A. & A. UHRIKOVA. 1974. Correction in Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · book-ipcn75-78 — Murin & Uhrikova 1974
CCDB · book-ipcn73-74 — MORTON, J.K. 1973. A cytological study of the British Labiatae excluding Mentha) (Lamiaceae). Watsonia 9: 239-246.
CCDB · book-ipcn73-74 — MARKOVA, M.L., & N.T. THU. 1974. In IOPB chromosome number reports XLIII. Taxon 23: 193-196.
CCDB · book-indian_vol1 — Mulligan, G.A. 1959 ; Uhrikoval & Murin (Fedorov) ; Morton, J.K. 1973 ; Markova, M.L. & Thu, N.T. 1974 '
CCDB · book-fedorov — Mulligan 1959
CCDB · book-fedorov — Uhrikova, Murin
CCDB · book-fedorov — L Slov. fl. I. 1967)
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
CCDB · CromoCat 2015 — Markova, M. & Thu, N. T. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIII]. Taxon 23(1): 193-194.
CCDB · CromoCat 2015 — Ubera, J. L. (1983a). Contribución al estudio cariológico del género Nepeta L. en la Península Ibérica. Lagascalia 11(1): 71-80.
2n 3617×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · fl-europaea +7
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · fl-europaea — Majovsky et al.,
CCDB · poland — Frey L., Mizianty M. and Mirek Z. 1981. Chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 581-590.
CCDB · ipcn-api-dl — Frey, L., M. Mizianty & Z. Mirek. 1981. Chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 581–590.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Rudyka, E. G. 1995. Chromosome numbers in vascular plants from the southern part of the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 80(2): 87–90.
CCDB · ipcn-api-dl — Gill, L. S. 1979. Cytotaxonomic studies of the tribe Nepeteae (Labiatae) in Canada. Genetica 50: 111–117.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · book-ipcn67-71 — LEE, Y.N. 1967. Chromosome numbers of flowering plants in Korea (1) J. Korean Cult. Res. Inst. 11: 455-478.
CCDB · book-ipcn67-71 — VAKAR, B.A., & N.B. LESHUKOVA. 1970. Karyosystematics of some Labiatae species (Tribe Nepeteae). Tsitologia 12: 789.
CCDB · book-indian_vol1 — Sugiura, T. 1937c, 1940a ; Lee, Y.N. 1967 ; Podlech, D. & Dieterle, A. 1969; Vakar, B.A. & Leshukova, N.B. 1970
CCDB · book-indian_vol1 — Gill, L.S. 1969
CCDB · book-fedorov — Sugiura 1937c, 1940a
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Frey, L., Mizianty, M. & Mirek, Z. (1981). Chromosome numbers of polish vascular plants. Fragm. Florist. Geobot. 27: 581-590.
CCDB · CromoCat 2015 — Rudyka, E. G. (1995). Chromosome numbers in vascular plants from the southern part of the Russian Far East Botani?eskij Žurnal (Moscow & Leningrad) 80(2): 87-90
2n 186×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
GoaT · Tree of Sex Database — ↗
CCDB · ipcn-api-dl — KACZMAREK, F. 1957. Nepeta cataria var. citriodora als Droge zur Gewinnung von Atherischem Ol. Pl. Med. (Stuttgart) 5: 51–56.
CCDB · book-ipcn75-78 — Kaczmarek 1957
CCDB · CromoCat 2015 — Kaczmarek, F. (1957). Nepeta cataria var. citriodora als Droge zur Gewinnung von Atherischem Ol. Pl. Med. (Stuttgart) 5: 51–56
TreeOfSex · plant — Goldblatt1979 ↗
2n 303×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-indian_vol1 — Maljovsky, J. et al. l970a
CCDB · CromoCat 2015 — Májovsky, J. (1970a). Index of chromosome numbers of Slovakian flora (part 2) Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 18: 45-60
2n 322×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Bushnell, E.P. 1936
CCDB · book-fedorov — Bushnell 1936
n 175×CCDB · ipcn-api-dl · CCDB · CromoCat 2015 · TreeOfSex · plant
CCDB · ipcn-api-dl — Gill, L. S. 1981. Chromosomal evolution and incidence of polyploidy in the Canadian Labiatae. Rev. Cytol. Biol. Vég., Bot. 4: 331–339.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — LEE, Y. N. 1967. Chromosome numbers of flowering plants in Korea. J. Korean Res. Inst. Ewha Women's Univ. 11: 455–478.
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
TreeOfSex · plant — Goldblatt1979 ↗
n 93×CCDB · ipcn-api-dl · TreeOfSex · plant
CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.
CCDB · ipcn-api-dl — Saggoo, M. I. S. & S. S. Bir. 1981. In Chromosome number reports LXXI. Taxon 30: 515.
TreeOfSex · plant — Goldblatt1979 ↗
n 182×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Gill, L. S. 1984. The incidence of polyploidy in the West-Himalayan Labiatae. Rev. Cytol. Biol. Vég., Bot. 7: 5–16.
CCDB · book-ipcn67-71 — GILL, L.S. 1969. In IOPB chromosome number reports XXI. Taxon 18: 310-315.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type35 117 records
Wild obs. + sensor29 058
Museum / vouchered5 876
Cultivated / captive15
Other168
Origin
Native61
Introduced1 024
Range
Area of Occupancy AOO82 976 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 13 132≤1 km 2 172≤10 km 8 306>10 km 843
24 453 georeferenced · 4 605 without coordinates
Open the mapobservation + sensor29 058
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 317≤1 km 923≤10 km 1 567>10 km 219
3 026 georeferenced · 2 850 without coordinates
Open the institutions mapphysical evidence5 876
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 3>10 km 8
11 georeferenced · 4 without coordinates
Open the mapnot free-living15
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions203 of 341 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Wuzhou, CN | 260 |
| Madison, US | 241 |
| BFLlocation not on record | 227 |
| LDlocation not on record | 203 |
| Moscow State Universitylocation not on record | 200 |
| Chongqing Museumlocation not on record | 183 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 130 |
| MeiseBGlocation not on record | 120 |
| St. Paul, US | 113 |
| Uppsala, SE | 108 |
| Bronx, US | 105 |
| Adam Mickiewicz University in Poznańlocation not on record | 104 |
| Chadron, US | 93 |
| SLU Artdatabankenlocation not on record | 91 |
| Spearfish, US | 88 |
| BDBClocation not on record | 83 |
| Olocation not on record | 75 |
| BIO-UNIPIlocation not on record | 75 |
| Oskarshamn, SE | 69 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 67 |
| Denver, US | 67 |
| GJOlocation not on record | 61 |
| WTUlocation not on record | 58 |
| Québec, CA | 58 |
| Pullman, US | 56 |
| Bloomington, US | 55 |
| Ann Arbor, US | 54 |
| Yangling, CN | 54 |
| Beijing, CN | 51 |
| Uniwersytet Wrocławskilocation not on record | 50 |
| Chengdu, CN | 46 |
| BClocation not on record | 45 |
| Bern, CH | 38 |
| University of New Hampshirelocation not on record | 37 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 35 |
| Moscow, US | 35 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 34 |
| Görlitz, DE | 33 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 32 |
| Burlington, US | 30 |
| Barcelona, ES | 29 |
| Missoula, US | 28 |
| New Haven, US | 28 |
| Tartu, EE | 28 |
| Nagano City, JP | 28 |
| South Kensington, GB | 27 |
| Bozeman, US | 27 |
| Corvallis, US | 27 |
| Salzburg, AT | 27 |
| Zürich, CH | 26 |
| Flagstaff, US | 26 |
| Saint Louis, US | 25 |
| Zürich, CH | 24 |
| Tallinn, EE | 24 |
| Allentown, US | 23 |
| Toronto, CA | 22 |
| Claremont, US | 22 |
| Acadia Universitylocation not on record | 21 |
| Williamsburg, US | 21 |
| GMBAlocation not on record | 21 |
| BRNUlocation not on record | 20 |
| Emporia, US | 20 |
| DOI/NPS, Greenbelt Parklocation not on record | 19 |
| Mlocation not on record | 19 |
| Green Bay, US | 19 |
| College Park, US | 19 |
| Auckland, NZ | 19 |
| Université Lavallocation not on record | 18 |
| Bangkok, TH | 18 |
| Christchurch, NZ | 18 |
| Riverside, US | 17 |
| Logan, US | 17 |
| University of Stellenboschlocation not on record | 17 |
| Philadelphia, US | 17 |
| Provo, US | 16 |
| Dresden, DE | 15 |
| Uniwersytet Śląski w Katowicachlocation not on record | 15 |
| Wlocation not on record | 14 |
| TUR-Alocation not on record | 13 |
| Urumqi, CN | 13 |
| Millersville, US | 13 |
| Frankfurt am Main | 13 |
| ASUlocation not on record | 13 |
| Dekalb, US | 13 |
| Museo Entomologico de Leonlocation not on record | 13 |
| Provincia di Livornolocation not on record | 12 |
| Albuquerque, US | 12 |
| Tsukuba, JP | 12 |
| LfUlocation not on record | 12 |
| MAlocation not on record | 12 |
| Oulu, FI | 11 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| Wellington, NZ | 11 |
| Mount Annan, AU | 11 |
| PRClocation not on record | 11 |
| Berlin, DE | 11 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 10 |
| McWane Science Centerlocation not on record | 10 |
| Regensburgische Botanische Gesellschaftlocation not on record | 10 |
| Trondheim, NO | 10 |
| Waverly, US | 10 |
| Brussel, BE | 9 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 9 |
| Boise, US | 9 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 9 |
| Uniwersytet Warszawskilocation not on record | 9 |
| Durango, US | 9 |
| IDElocation not on record | 9 |
| Vitoria, ES | 9 |
| Chapel Hill, US | 9 |
| Zhengzhou, CN | 9 |
| Davenport, US | 8 |
| Cheney, US | 8 |
| València, ES | 8 |
| Durham, US | 8 |
| Whitewater, US | 8 |
| Pocatello, US | 8 |
| Turku, FI | 8 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 8 |
| Hobart, AU | 8 |
| WNNUlocation not on record | 8 |
| Austin, US | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| QAUlocation not on record | 8 |
| Hudson, US | 8 |
| Montréal, CA | 8 |
| Santa Barbara, US | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| Weber State Universitylocation not on record | 7 |
| GZUlocation not on record | 7 |
| Victoria, CA | 7 |
| Lincoln, US | 7 |
| Caldwell, US | 7 |
| Fort Worth, US | 7 |
| Córdoba, AR | 7 |
| Seoul, KR | 7 |
| Bergen, NO | 7 |
| Museum of the Rockieslocation not on record | 7 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 7 |
| Columbia, US | 7 |
| Staten Island, US | 7 |
| Beijing, CN | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Lord Fairfax Community Collegelocation not on record | 6 |
| Canberra, AU | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Mohonk Preservelocation not on record | 6 |
| Porvoo, FI | 6 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Montréal, CA | 6 |
| New Brunswick, US | 5 |
| San Luis Obispo, US | 5 |
| Chicago, US | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 5 |
| KR | 5 |
| Northridge, US | 5 |
| Chicago, US | 5 |
| Fairfax, US | 5 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 5 |
| Adelaide, AU | 5 |
| US | 5 |
| Saint John, CA | 5 |
| Entomological Society of Latvialocation not on record | 5 |
| Vancouver, CA | 5 |
| Salamanca, ES | 5 |
| US | 5 |
| Keene State Universitylocation not on record | 5 |
| Nanjing, CN | 5 |
| Granada, ES | 5 |
| CJBGlocation not on record | 5 |
| Arcata, US | 5 |
| Mount Pleasant, US | 5 |
| Lubbock, US | 4 |
| DBF-NHMDlocation not on record | 4 |
| H-AkrKGlocation not on record | 4 |
| Pittsburg, US | 4 |
| CASlocation not on record | 4 |
| Bourges, FR | 4 |
| Castelar, AR | 4 |
| Ypsilanti, US | 4 |
| Phoenix, US | 4 |
| Knoxville, US | 4 |
| Tacoma, US | 4 |
| Porrentruy, CH | 4 |
| Xining, CN | 4 |
| Xian, CN | 4 |
| Hazara Universitylocation not on record | 4 |
| Davis, US | 4 |
| Los Angeles, US | 4 |
| Mississippi State, US | 4 |
| Blumenau, BR | 4 |
| Brookings, US | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Pamplona, ES | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Chengdu, CN | 3 |
| Universität Erlangen-Nürnberglocation not on record | 3 |
| Wuhan, CN | 3 |
| Henderson, US | 3 |
| Sanda, JP | 3 |
| USFS/BHSClocation not on record | 3 |
| UGentlocation not on record | 3 |
| Guiyang, CN | 3 |
| National Museum Waleslocation not on record | 3 |
| Whitehorse, CA | 3 |
| Paris, FR | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| TROMlocation not on record | 3 |
| Sion, CH | 3 |
| Jyväskylä, FI | 3 |
| Podgorica, ME | 3 |
| Washington, US | 3 |
| University of Alberta Museumslocation not on record | 2 |
| Jurica-Suchy Nature Museumlocation not on record | 2 |
| Glarus, CH | 2 |
| Fulda, DE | 2 |
| Rotorua, NZ | 2 |
| Tilburg, NL | 2 |
| Norfolk, US | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Springfield, US | 2 |
| Mexico City, MX | 2 |
| Santa Cruz, US | 2 |
| Taipei, TW | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Coimbra, PT | 2 |
| Urumqi, CN | 2 |
| Lanzhou, CN | 2 |
| AUAlocation not on record | 2 |
| Philadelphia, US | 2 |
| Parkville, AU | 2 |
| University of South Dakotalocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Turlock, US | 2 |
| Alicante, ES | 2 |
| No collectionlocation not on record | 2 |
| Chongqing Natural History Museumlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| US | 2 |
| SZUlocation not on record | 2 |
| ER Hellerlocation not on record | 2 |
| WINlocation not on record | 2 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 2 |
| Fredericksburg, US | 2 |
| Orem, US | 2 |
| Morgantown, US | 2 |
| JBSlocation not on record | 2 |
| Jackson, US | 2 |
| San Angelo, US | 2 |
| GAlocation not on record | 2 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 2 |
| H-Schuhwlocation not on record | 2 |
| Fayetteville, US | 2 |
| Madrid, ES | 2 |
| Karlsruhe, DE | 1 |
| Philadelphia, US | 1 |
| Pomona Collegelocation not on record | 1 |
| EL PASO, US | 1 |
| Osaka, JP | 1 |
| Stockholm, SE | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| H-Adlerlocation not on record | 1 |
| Bend, US | 1 |
| Macomb, US | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Odawara, JP | 1 |
| Tuscaloosa, US | 1 |
| San Isidro, AR | 1 |
| HUN003location not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| ESP003location not on record | 1 |
| NoColllocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Otaru, JP | 1 |
| DULlocation not on record | 1 |
| Asheville, US | 1 |
| San Diego, US | 1 |
| Baltimore, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Minia, EG | 1 |
| Due West, US | 1 |
| UNESClocation not on record | 1 |
| University of Bayreuthlocation not on record | 1 |
| Kew, GB | 1 |
| CICYTEXlocation not on record | 1 |
| 云南省思茅市民族传统医药研究所location not on record | 1 |
| BSBIlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Boumlocation not on record | 1 |
| Wuhan, CN | 1 |
| Xiamen, CN | 1 |
| Chicago, US | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| SCAUlocation not on record | 1 |
| SXTCMlocation not on record | 1 |
| Clemson, US | 1 |
| Harrisonburg, US | 1 |
| Maringá, BR | 1 |
| Museo Achille Folettolocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Fribourg, CH | 1 |
| Criciúma, BR | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Cambridge, US | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| JBCLMlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| Kuopio, FI | 1 |
| Sant Julià de Lòria, AD | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Fargo, US | 1 |
| Walla Walla, US | 1 |
| Kunming, CN | 1 |
| Grand Junction, US | 1 |
| Göteborg, SE | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Pamplona, ES | 1 |
| Angwin, US | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Nijmegen, NL | 1 |
| FLADlocation not on record | 1 |
| Dhaka, BD | 1 |
| Lausanne, CH | 1 |
| VALElocation not on record | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Guangzhou, CN | 1 |
| San Francisco, US | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| University of Southern Mississippilocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| KMNlocation not on record | 1 |
| Kingston, US | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| UFSClocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
341 institutions · 5 452 of 5 876 vouchered records shown · 398 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA21 detections
Where the DNA of Nepeta cataria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map5 countries0
gravel roadside with grasses
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.8 °C 15.2–21.9
Seasonal swing summer↔winter22.4 °C
Max temp (day)20.8 °C 17.5–27.0
Min temp (night)14.5 °C 11.1–17.9
Precipitation81.8 mm/mo 26.8–90.7
Air humidity61.0 % 48.3–63.7
Moisture balance-49.1 mm/mo -92.9–7.10
Vapour deficit808 Pa 642–1,383
Wind speed3.50 m/s 1.90–6.20
Cloud cover39.7 % 26.0–50.8
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.