Nepenthes edwardsiana

H.Low ex Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Nepenthaceae/Nepenthes

At a glance

Occurrence records78

Data sources9

Biological traits3

DNA specimens13

eDNA detections5

Sources9 archives

Databases and archives Nepenthes edwardsiana's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources3 traits

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI13 specimens

01Narrative

Nepenthes edwardsiana , or the splendid pitcher-plant,Phillipps, A. & A. Lamb 1996. Pitcher-Plants of Borneo. Natural History Publications (Borneo), Kota Kinabalu. is a carnivorous tropical pitcher plant endemic to Mount Kinabalu and neighbouring Mount Tambuyukon in Sabah, Malaysian Borneo. It is considered one of the most spectacular of all Nepenthes, producing some of the largest pitchers and the most highly developed peristome ribs of any species in the genus.Clarke, C.M. 1997. Nepenthes of Borneo. Natural History Publications (Borneo), Kota Kinabalu.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction1

Life formliana

Habitat & environment2

Climatewet tropical

Woodinessvariable

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nepenthes edwardsiana has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes3

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP978895.1 ↗730 bpMalaysia · 2012

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAAATTGCCAAGCAGAGCGACCCGCGGACATGTTGAAATAA …

Nepenthes edwardsiana voucher RMS019 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★ITS4trnK

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type78 records

Wild obs. + sensor53

Museum / vouchered25

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 53

53 georeferenced

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Naturalis Biodiversity Centerlocation not on record	4

1 institutions · 4 of 25 vouchered records shown · 21 without an institution code

09Environmental DNA5 detections

Where the DNA of Nepenthes edwardsiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 21.0–21.0

Seasonal swing summer↔winter1.10 °C

Max temp (day)24.9 °C

Min temp (night)17.1 °C

Precipitation360 mm/mo

Air humidity66.3 %

Moisture balance237 mm/mo

Vapour deficit831 Pa

Wind speed1.20 m/s

Cloud cover67.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)