Neorites kevedianus

L.S.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Neorites

At a glance

Occurrence records160

Data sources7

Biological traits23

DNA specimens3

eDNA detections4

Sources7 archives

Databases and archives Neorites kevedianus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF160 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT631 Mbp

01Narrative

Neorites is a monotypic genus of plants in the family Proteaceae. The sole species Neorites kevedianus, commonly called fishtail oak or fishtail silky oak, is a tall tree endemic to the wet tropics rainforests of north eastern Queensland, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology10

Fruit length60 mm

Fruit width17.5 mm

Leaf length105 mm

Leaf mass per area82.55 g/m2

Leaf size36 800 mm²

Leaf width30 mm

Petiole length3.5 cm

Plant height30 m

Seed length30 mm

Seed width9 mm

Life cycle & reproduction4

Flowering timennnnynnnnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite

Habitat & environment8

Climatewet tropical

Climberself-supporting

Fruit fleshinessdry

Fruit typefollicle

Growth formtree

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neorites kevedianus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU676095.1 ↗701 bp

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTGCCCCGACGGAGAGACCCGCGAACACGTTGCATGGCCGTCGGGGGAAAGGGCGT …

Neorites kevediana 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Neorites kevedianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size630 810 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Neorites kevedianus0.63 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type160 records

Wild obs. + sensor5

Museum / vouchered137

Cultivated / captive1

Other17

Origin

Native18

Introduced3

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤1 km 4>10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 4≤1 km 28≤10 km 61>10 km 18

111 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence137

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	59
Brisbane, AU	25
Mount Annan, AU	20
Canberra, AU	6
Museo Entomologico de Leonlocation not on record	6
Kew, GB	5
Palmerston, AU	2
Australian Tropical Herbariumlocation not on record	1
ASUlocation not on record	1
Saint Louis, US	1
Parkville, AU	1

11 institutions · 127 of 137 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Neorites kevedianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 22.1–23.8

Seasonal swing summer↔winter12.5 °C

Max temp (day)28.0 °C 27.6–28.4

Min temp (night)17.8 °C 15.5–20.0

Precipitation200 mm/mo 52.4–347

Air humidity56.3 % 46.0–66.6

Moisture balance24.1 mm/mo -109–157

Vapour deficit1,273 Pa 993–1,554

Wind speed2.90 m/s 2.10–3.80

Cloud cover39.5 % 22.4–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)