Neorhodomela larix

(Turner) Masuda, 1982 · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Ceramiales/Rhodomelaceae/Neorhodomela

At a glance

Occurrence records3 384

Data sources9

Biological traits2

DNA specimens55

eDNA detections83

Sources9 archives

Databases and archives Neorhodomela larix's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 600 records↗

OBISOcean Biodiversity Information System784 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI83 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionNPASS7 compounds

Occurrence & distributionGBIF · OBIS3 384 records

Environmental DNA2 datasets · 2 countries83 detections

DNA & barcodingBOLD · NCBI55 specimens

01Narrative

Neorhodomela larix, commonly known as black pine, is a species of red algae native to coastal areas of the North Pacific, from Mexico to the Bering Sea to Japan. It forms dense mats on semi-exposed rocks in intertidal areas. The thallus is dark brown to black in color with whorled branches resembling a bottlebrush.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

03Chemical composition7 compounds

Compounds documented for Neorhodomela larix across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Kavalactones and derivatives5

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
3-(1-Acetyl-1,5,6-trihydroxyinden-2-yl)-8,9-dihydroxypyrano[4,3-c]isochromene-1,6-dione	present	NPASS
3-(5',6'-Dihydroxy-5-methyl-3-oxospiro[uran-2,1'-indene]-2'-yl)-8,9-dihydroxypyrano[4,3-c]isochromene-1,6-dione	present	NPASS
3-[(2R)-5-[(E)-2-(3,4-dihydroxyphenyl)ethenyl]-5',6'-dihydroxy-3-oxospiro[furan-2,1'-indene]-2'-yl]-8,9-dihydroxypyrano[4,3-c]isochromene-1,6-dione	present	NPASS
DMDPGBWTAWPKOU-SNAWJCMRSA-N	present	NPASS
Inonoblin C	present	NPASS
Phelligridin D	present	NPASS
Phelligridin I	present	NPASS

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neorhodomela larix has left across the world's sequence archives.

At a glance

DNA specimens55

BINs1

Marker genes4

GenBank sequences5

eDNA detections83

The DNA barcodea real sequence read deposited for this species

rbcLAF259499.1 ↗1 014 bp

ACGT

AAAAATGAACGTTATGAATCTGGTGTAATACCATATGCAAAAATGGGATATTGGGATCCTAAATATGTAATTAAAGATACAGATGTATTA …

Neorhodomela larix ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhodomela teressame family9.6%Rhodomela tenuissimasame family9.9%Odonthalia lyalliisame family10.5%Rhodomela sibiricasame family10.5%Rhodomela lycopodioidessame family10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL528S28S-D2

animal barcodeplant barcodemarker

08Occurrence & distribution

Record type3 384 records

Wild obs. + sensor2 257

Museum / vouchered998

Other129

Range

Area of Occupancy AOO3 292 km²

Depth

0–200 m sunlit438

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 0.2 m · 438 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 627≤1 km 923≤10 km 31>10 km 20

1 601 georeferenced · 656 without coordinates

Open the mapobservation + sensor2 257

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 13≤1 km 108≤10 km 54>10 km 4

179 georeferenced · 819 without coordinates

Open the institutions mapphysical evidence998

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	474
Stanford Universitylocation not on record	33
US	31
Ann Arbor, US	27
Arcata, US	23
Corvallis, US	21
Chapel Hill, US	19
Friday Harbor Laboratories, University of Washingtonlocation not on record	14
San Diego, US	11
National Marine Biodiversity Institute of Korealocation not on record	11
Los Angeles, US	11
University of Stellenboschlocation not on record	10
Durham, US	8
Edmonton, CA	5
WTUlocation not on record	5
McWane Science Centerlocation not on record	4
KMNlocation not on record	3
Burlington, US	3
Columbia, US	3
Davis, US	3
Bronx, US	3
Severin-McDaniel Insect Collectionlocation not on record	3
Minia, EG	2
Durham, US	1
New Haven, US	1
Hakai Institutelocation not on record	1
PHlocation not on record	1
National Institute of Biological Resourceslocation not on record	1
Trondheim, NO	1
Santa Cruz, US	1

30 institutions · 734 of 998 vouchered records shown · 217 without an institution code

09Environmental DNA83 detections

Where the DNA of Neorhodomela larix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found83

Studies independent surveys2

Countries2

Verifiable raw sequence linked33

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 83 detections have coordinates

Open the map2 countries0

bedrockRocky intertidal shoreLow intertidal, epilithic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 10.7–13.6

Seasonal swing summer↔winter7.40 °C

Max temp (day)13.1 °C 11.7–16.0

Min temp (night)9.00 °C 8.50–11.7

Precipitation130 mm/mo 65.1–173

Air humidity63.7 % 63.2–67.5

Moisture balance66.1 mm/mo

Vapour deficit464 Pa 422–538

Wind speed4.20 m/s

Cloud cover49.6 % 37.1–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 81 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neorhodomela larix

At a glance

Sources9 archives

Habitat & environment2

Compound class profile1 class

Documented compounds7 total

At a glance

Record type3 384 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 384 records