Neoregelia pascoaliana

L.B.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Neoregelia

At a glance

Occurrence records31

Data sources5

Biological traits9

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Neoregelia pascoaliana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF31 records

DNA & barcodingNCBIsequences

01Narrative

Neoregelia pascoaliana is a species in the genus Neoregelia. This is a species that is endemic to Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial), Restinga

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neoregelia pascoaliana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKMT026329.1 ↗782 bpBrazil

ACGT

ATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACG …

Neoregelia pascoaliana isolate BE583 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor2

Museum / vouchered29

Origin

Native9

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidade Federal do Espírito Santolocation not on record	5
UFESlocation not on record	4
Bronx, US	4
University of Stellenboschlocation not on record	4
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	2
INMAlocation not on record	2
Santa Teresa, BR	2
UFPElocation not on record	1
Cruz das Almas, BR	1
CEPLAClocation not on record	1
Kew, GB	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
JBRJlocation not on record	1

13 institutions · 29 of 29 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)