Neoregelia cruenta

(Graham) L.B.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Neoregelia

At a glance

Occurrence records187

Data sources9

Biological traits15

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Neoregelia cruenta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF187 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Neoregelia cruenta is a species in the genus Neoregelia. This species is endemic to Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Deciduousnessevergreen

Life formepiphyte or lithophyte

Life spanperennial

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphytefacultative

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTManguezal, Restinga, Vegetação Sobre Afloramentos Rochosos

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry2

Leaf n6.2 mg/g

Photosynthetic pathwayCAM

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neoregelia cruenta has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX783932.1 ↗552 bpEgypt · 2012

ACGT

AGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCA …

Neoregelia cruenta voucher Hosam00403 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Neoregelia cruenta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 541×CCDB · book-fedorov

CCDB · book-fedorov — Lindschau 1933

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type187 records

Wild obs. + sensor111

Museum / vouchered76

Origin

Native16

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 53≤1 km 26≤10 km 12>10 km 5

96 georeferenced · 15 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 76 records without

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
JBRJlocation not on record	10
UFESlocation not on record	9
Federal University of Espírito Santolocation not on record	9
Bronx, US	6
University of Stellenboschlocation not on record	6
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	5
INMAlocation not on record	4
UFRRJlocation not on record	3
Chicago, US	3
Universidade Federal do Espírito Santolocation not on record	3
Seropédica, BR	2
Kew, GB	2
Salvador, BR	2
HUENFlocation not on record	1
UFBAlocation not on record	1
Laboratorio de Ictiologialocation not on record	1
UNESClocation not on record	1
CEPLAClocation not on record	1
Criciúma, BR	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Universidad Nacional Federico Villarreallocation not on record	1
Alexandria Universitylocation not on record	1

22 institutions · 73 of 76 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Neoregelia cruenta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 18.2–18.2

Seasonal swing summer↔winter11.7 °C

Max temp (day)21.4 °C

Min temp (night)15.0 °C

Precipitation3.10 mm/mo

Air humidity59.8 %

Moisture balance-143 mm/mo

Vapour deficit839 Pa

Wind speed4.70 m/s

Cloud cover31.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)