Neopanax colensoi

(Hook.fil.) Allan · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Araliaceae/Neopanax

At a glance

Occurrence records17

Data sources10

Biological traits36

DNA specimens0

eDNA detections5

Sources10 archives

Databases and archives Neopanax colensoi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources36 traits

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 48

01Narrative

Pseudopanax colensoi is a species of evergreen plant.Peter Wardle. 1991 This species is native to New Zealand. An example occurrence in central Westland podocarp/broadleaf forests includes flora associates such as Cyathea smithii and Dicksonia squarrosa, Rumohra adiantiformis, Ascarina lucida, Pseudowintera colorata and Blechnum discolor.C. Michael Hogan. 2009 The maximum height of this plant is 5 meters and it is the preferred food of possums.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length5 mm

Leaf length max110 mm

Leaf width65 mm

Leaf width max65 mm

Leaf width min65 mm

Plant height3.46 m

Plant height max5 m

Seed length4 mm

Seed length max4 mm

Seed length min4 mm

Seed mass5.9 mg

⚠ sources differ — TRY: 5.9 mg · GIFT: 3 mg

Seed mass max3 mg

Seed mass min3 mg

Seed volume34 mm³

Seed volume max34 mm³

Seed volume min34 mm³

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Habitat GIFTLowland

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry6

Leaf dry-matter content (LDMC)374 mg/g

Leaf n8.57 mg/g

Leaf p0.753 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)5.39 mm²/mg

Wood density506 mg/cm³

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neopanax colensoi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

eDNA detections5

The DNA barcodea real sequence read deposited for this species

rbcLFJ470137.1 ↗1 274 bp

ACGT

TTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTG …

Pseudopanax colensoi var. colensoi voucher WELT SP86431 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Neopanax colensoi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×CCDB · new-zealand

CCDB · new-zealand

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type17 records

Wild obs. + sensor9

Museum / vouchered7

Cultivated / captive1

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 5>10 km 1

6 georeferenced · 3 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence7

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	3
Christchurch, NZ	3
Moscow State Universitylocation not on record	1

3 institutions · 7 of 7 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Neopanax colensoi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)