Neopallasia pectinata

(Pall.) Poljakov · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Neopallasia

At a glance

Occurrence records638

Data sources10

Biological traits27

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Neopallasia pectinata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources27 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF638 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Neopallasia is a genus of Asian flowering plants in the chamomile tribe within the daisy family.Poljakov, Petr Petrovich. 1955. Botanicheskie Materialy Gerbariya Botanicheskogo Instituta Imeni V. L. Komarova Akademii Nauk S S S R. Leningrad 17: 429Tropicos, Neopallasia PoljakovAuthors: Zhu Shi, Christopher J. Humphries & Michael G. Gilbert. Flora of China; Neopallasia Poljakov. Accessed Oct. 31, 2012. http://www.efloras.org/florataxon.aspx?flora_id=2&taxon_id=122037Watson, Linda E.; Bates, Paul L,; Evans, Timothy M,; Unwin Matthew M,; and James R. Estes. 2002. Molecular phylogeny of Subtribe Artemisiinae (Asteraceae), including Artemisia and its allied and segregate genera. BMC Evolutionary Biology 2:17. doi:10.1186/1471-2148-2-17 Molecular data indicate that Neopallasia is closely related to Seriphidium and could be easily included with that genus. Species The only accepted species is Neopallasia pectinata. Neopallasia pectinata is an erect herb, 12–40 cm tall with pinnately divided sessile oblong-elliptic leaves. This plant of deserts grows in gravelly river valleys and wastelands at 1300–3400 m elevation. This variable species is known from northern and western China (provinces of Gansu, Hebei, Heilongjiang, Jilin, Liaoning, Inner Mongolia, Ningxia, Qinghai, Shanxi, Shaanxi, Sichuan, Xinjiang, Yunnan, Tibet) as well as Kazakhstan, Kyrgyzstan, Uzbekistan, Mongolia, and Russia (Altay and Chita).Authors: 栉叶蒿 Zhi Yehao. Flora of China, 栉叶蒿属 zhi ye hao shu Neopallasia pectinata Poljakov. Accessed Oct. 31, 2012. http://www.efloras.org/florataxon.aspx?flora_id=2&taxon_id=242333577Flann, C (ed) 2009+ Global Compositae Checklist

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology13

Fruit length1.35 mm

Fruit length max1.5 mm

Fruit length min1.2 mm

Inflorescence length max0.4 cm

Inflorescence length min0.3 cm

Leaf length22.5 mm

Leaf length max30 mm

Leaf length min15 mm

Leaf width7.5 mm

Leaf width max10 mm

Leaf width min5 mm

Plant height max0.4 m

Plant height min0.12 m

Life cycle & reproduction6

Dispersal typewind

Flowering endAug

Flowering startAug

Life spanannual

Raunkiær life formtherophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Growth formherb

Habitat GIFTdesert, plains, sand, steppe

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)11.57 mm²/mg

03Chemical composition9 compounds

Compounds documented for Neopallasia pectinata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Eudesmane sesquiterpenoids2

Eremophilane sesquiterpenoids2

Furofuranoid lignans1

Cholestane steroids $ Stigmastane steroids1

Isoquinoline alkaloids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(2E,5R)-2-hexa-2,4-diynylidene-1,10-dioxaspiro[4.5]dec-3-ene	present	LOTUS
(3aR,4aR,5S,9aR)-4a,5-dimethyl-3-methylidene-4,5,6,7,8,9a-hexahydro-3aH-benzo[f][1]benzofuran-2-one	present	LOTUS
17-(5-ethyl-6-methylhept-3-en-2-yl)-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
2-[(2R,3S,4aR)-3-acetyloxy-4a,8-dimethyl-2,3,4,5,6,7-hexahydro-1H-naphthalen-2-yl]prop-2-enoic acid	present	LOTUS
2-[(2R,3S,4aR)-3-hydroxy-4a,8-dimethyl-2,3,4,5,6,7-hexahydro-1H-naphthalen-2-yl]prop-2-enoic acid	present	LOTUS
4-Hydroxybenzoic acid	present	LOTUS
5',6'-Dimethoxy-2',3',8',8a'-tetrahydro-1'h,4h-spiro[cyclohexa-2,5-diene-1,7'-cyclopenta[ij]isoquinolin]-4-one	present	LOTUS
NCGC00169769-02_C15H22O2_2-Naphthaleneacetic acid, 1,2,3,5,6,7,8,8a-octahydro-8,8a-dimethyl-alpha-methylene-, (2R,8S,8aR)-	present	LOTUS
Syringaresinol	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neopallasia pectinata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSON100552.1 ↗637 bpMongolia

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGCGAACACGTAAAAACAACCGAGTGTCGATTGGGTCAAGCTCTTGTTTGGTCCTCTCGACGCTT …

Neopallasia pectinata isolate NEOpec_A1136 internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Neopallasia pectinata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–362n range18median18mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1810×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 10

CCDB · iapt

CCDB · ipcn-api-dl — Krasnikov, A. A., O. S. Zhirova, M. N. Lomonosova & S. V. Smirnov. 2003. Chromosome numbers of Asteraceae from the southern Siberia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 88(9): 151–153.

CCDB · ipcn-api-dl — Garcia, S. 2006. New or rarely reported chromosome numbers in taxa of subtribe Artemisiinae (Anthemideae, Asteraceae) from Mongolia. Bot. J. Linn. Soc. 150: 203–210.

CCDB · ipcn-api-dl — Qiao, Y. m., X. x. Yan & S. z. Zhang. 1990. A study on the chromosomes of 20 species of the genus Artemisia. Grassl. China 1990(6): 24–31.

CCDB · iapt — IAPT/IOPB Chromosome Data 19

CCDB · iapt — IAPT/IOPB Chromosome Data 26

2n 362×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Valles, J. 2005. Chromosome numbers in the tribes Anthemideae and Inuleae (Asteraceae). Bot. J. Linn. Soc. 148: 77–85.

CCDB · kew — Garcia S, Sanz M, Garnatje T et al. 2004. Variation of DNA amount in 47 populations of the subtribe Artemisiinae and related taxa (Asteraceae, Anthemideae): karyological, ecological, and systematic implications. Genome 47: 1004-1014.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type638 records

Wild obs. + sensor216

Museum / vouchered421

Other1

Range

Area of Occupancy AOO1 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 54≤1 km 13≤10 km 10>10 km 48

125 georeferenced · 91 without coordinates

Open the mapobservation + sensor216

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 4≤10 km 8>10 km 2

14 georeferenced · 407 without coordinates

Open the institutions mapphysical evidence421

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	183
Yangling, CN	47
Institute of Applied Ecology, Academia Sinicalocation not on record	34
Moscow State Universitylocation not on record	34
Lanzhou, CN	31
WNNUlocation not on record	16
Urumqi, CN	11
Jiangxi College of Educationlocation not on record	11
Beijing, CN	10
Xining, CN	7
Chengdu, CN	6
Kunming, CN	5
Guangzhou, CN	4
GMBAlocation not on record	4
Nanjing, CN	3
IMMUlocation not on record	3
ENTClocation not on record	2
BRNUlocation not on record	1
Wlocation not on record	1
Frankfurt am Main	1
Kew, GB	1
Chengdu, CN	1
Odawara, JP	1
Chongqing Natural History Museumlocation not on record	1

24 institutions · 418 of 421 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Neopallasia pectinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)