Neonicholsonia watsonii

Dammer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Neonicholsonia

At a glance

Occurrence records154

Data sources8

Biological traits26

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Neonicholsonia watsonii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility154 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF154 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Neonicholsonia is a monotypic genus of flowering plant in the palm family native to Central America (Honduras, Nicaragua, Costa Rica, Panama).Kew World Checklist of Selected Plant FamiliesStevens, W.D., Ulloa U., C., Pool, A. & Montiel, O.M. (2001). Flora de Nicaragua. Monographs in Systematic Botany from the Missouri Botanical Garden 85: i-xlii, 1-2666.Hammel, B.E. & al. (2003). Manual de Plantas de Costa Rica 2: 1-694. Missouri Botanical Garden Press, St. Louis.Govaerts, R. & Dransfield, J. (2005). World Checklist of Palms: 1-223. The Board of Trustees of the Royal Botanic Gardens, Kew.Nelson Sutherland, C.H. (2008). Catálogo de las plantes vasculares de Honduras. Espermatofitas: 1-1576. SERNA/Guaymuras, Tegucigalpa, Honduras. The sole species is Neonicholsonia watsonii. The genus and species names honor George Nicholson, a former curator of the Royal Botanic Gardens, Kew and his successor William Watson.Riffle, Robert L. and Craft, Paul (2003) An Encyclopedia of Cultivated Palms. Portland: Timber Press. /

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length9.5 mm

Fruit length max10 mm

Fruit length min9 mm

Fruit width5.5 mm

Fruit width max6 mm

Fruit width min5 mm

Leaf length max2 200 mm

Plant height1 m

Life cycle & reproduction3

Life formperennial or subshrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit colourblack

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Treelet

Habitat GIFTunderstorey

Woodinesswoody

Other traits4

Dbh max13 cm

Defenseno

Leaf spinesno

Shoot length max100 cm

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neonicholsonia watsonii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG437668.1 ↗1 358 bp

ACGT

TGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCG …

Neonicholsonia watsonii voucher L-81.0303 (BH) ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★trnL-F

plant barcode

07Deep time~15.6 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin15.6 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type154 records

Wild obs. + sensor4

Museum / vouchered150

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1≤10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 150 records without

Open the institutions mapphysical evidence150

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	53
Saint Louis, US	46
Museo Nacional de Costa Rica (MNCR)location not on record	28
Bronx, US	5
San José, CR	5
León, NI	3
Kew, GB	2
Mexico City, MX	2
Universidad Nacional Autónoma de Honduraslocation not on record	1
COLlocation not on record	1
Instituto Nacional de Biodiversidadlocation not on record	1
Cornell Universitylocation not on record	1
Xiamen, CN	1

13 institutions · 149 of 150 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Neonicholsonia watsonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 10.1–10.1

Seasonal swing summer↔winter10.7 °C

Max temp (day)11.8 °C

Min temp (night)7.90 °C

Precipitation93.6 mm/mo

Air humidity63.4 %

Moisture balance22.4 mm/mo

Vapour deficit469 Pa

Wind speed4.80 m/s

Cloud cover50.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)