Neonectria ditissima

(Tul. & C.Tul.) Samuels & Rossman · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Nectriaceae/Neonectria

At a glance

Occurrence records839

Data sources10

Biological traits0

DNA specimens26

eDNA detections33

Sources10 archives

Databases and archives Neonectria ditissima's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility839 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF839 records

Environmental DNA1 datasets · 5 countries33 detections

DNA & barcodingBOLD · NCBI26 specimens

Genome at a glanceGoaT · NCBI≈46 Mbp

01Narrative

N. galligena canker on trunk Neonectria ditissima (syn. Neonectria galligena) is a fungal plant pathogen. It causes cankers that can kill branches of trees by choking them off. Apple and beech trees are two susceptible species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition9 compounds

Compounds documented for Neonectria ditissima across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Tetraketide meroterpenoids7

Cholestane steroids1

Zearalenones1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
3-(3,7-Dimethylocta-2,6-dienyl)-2,4-dihydroxy-6-methylbenzaldehyde	present	LOTUS
3-[(2E)-3,7-dimethylocta-2,6-dienyl]-2,4-dihydroxy-6-methylbenzaldehyde	present	LOTUS
5-Chloro-3-(3,7-dimethylocta-2,6-dienyl)-2,4-dihydroxy-6-methylbenzaldehyde	present	LOTUS
Cholesterol, 7-dehydro-	present	LOTUS
Colletochlorin B	present	LOTUS
Dehydrocurvularin	present	LOTUS
Ilicicolin C	present	LOTUS
Ilicicolin E	present	LOTUS
Ilicicolin F	present	LOTUS

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neonectria ditissima has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes3

GenBank sequences10

eDNA detections33

Countries7

The DNA barcodea real sequence read deposited for this species

ITSON740651.1 ↗310 bpBrazil

ACGT

TTGTTTTATACAGCATCTTCTGAGTAACACGATTAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACG …

Neonectria ditissima isolate LEMID-MdNd18-16 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Neonectria ditissima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈46 203 877 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Neonectria ditissima0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness98.3% BUSCO

08Occurrence & distribution

Record type839 records

Wild obs. + sensor672

Museum / vouchered156

Cultivated / captive11

Range

Area of Occupancy AOO2 392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 271≤1 km 185≤10 km 187>10 km 10

653 georeferenced · 19 without coordinates

Open the mapobservation + sensor672

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 7≤1 km 66≤10 km 30>10 km 3

106 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence156

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 10 without coordinates

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	61
Tartu, EE	14
Turku, FI	5
DPIlocation not on record	5
Bernard Price Institute for Palaeontological Researchlocation not on record	4
Helsinki, FI	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
SLU Artdatabankenlocation not on record	3
WU-MYClocation not on record	3
LDlocation not on record	3
Mlocation not on record	2
San Sebastián, ES	2
Museo Entomologico de Leonlocation not on record	2
Görlitz, DE	1
Agriculture and Agri-Food Canada, Canadian National Mycological Herbariumlocation not on record	1
Stockholm, SE	1
Gijón, ES	1
Kew, GB	1
Copenhagen, DK	1
Canberra, AU	1
nsnflocation not on record	1
Champaign, US	1

22 institutions · 120 of 156 vouchered records shown · 31 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA33 detections

Where the DNA of Neonectria ditissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 6.80–10.5

Seasonal swing summer↔winter19.1 °C

Max temp (day)13.4 °C 11.0–14.3

Min temp (night)5.50 °C 2.90–6.60

Precipitation87.1 mm/mo 64.6–102

Air humidity62.8 % 60.6–63.9

Moisture balance10.8 mm/mo -4.10–29.1

Vapour deficit485 Pa 453–543

Wind speed3.40 m/s 2.50–5.00

Cloud cover44.5 % 42.9–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)