Neomyrtus pedunculata

(Hook.fil.) Allan · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Neomyrtus

At a glance

Occurrence records6 314

Data sources10

Biological traits30

DNA specimens8

eDNA detections8

Sources10 archives

Databases and archives Neomyrtus pedunculata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 314 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF6 314 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Neomyrtus is a genus of plants in the family Myrtaceae described in 1941.Burret, (Maximilian) Karl Ewald. 1941. Notizblatt des Botanischen Gartens und Museums zu Berlin-Dahlem 15: 493Tropicos, Neomyrtus Burret It contains only one known species, Neomyrtus pedunculata, endemic to New Zealand. It is found there on both the North Island and the South Island.Kew World Checklist of Selected Plant FamiliesGovaerts, R., Sobral, N., Ashton, P., Barrie, F., Holst, B.K., Landrum, L.L., Matsumoto, K., Fernanda Mazine, F., Nic Lughadha, E., Proença, C. & al. (2008). World Checklist of Myrtaceae: 1-455. Kew Publishing, Royal Botanic Gardens, Kew.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length6 mm

Leaf length max21 mm

Leaf width13 mm

Leaf width max13 mm

Leaf width min13 mm

Plant height2.84 m

Plant height max6 m

Seed length2.3 mm

Seed length max2.3 mm

Seed length min2.3 mm

Seed mass3 mg

Seed mass max3 mg

Seed mass min3 mg

Life cycle & reproduction6

Deciduousnessdeciduous

⚠ sources differ — TRY: D · GIFT: evergreen

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Reproduction asexualabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub

Habitat GIFTCoastal

Mycorrhizaabsent

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density733 mg/cm³

03Chemical composition2 compounds

Compounds documented for Neomyrtus pedunculata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Gallotannins2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3-Methylellagic acid		present	LOTUS
Ellagic acid		present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neomyrtus pedunculata has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM064949.1 ↗601 bp

ACGT

ATGACCAGAGAACTCGTAACGAACTCAATGGGGACGGTGGGTTTTTTTCCCATCGTCCCTCGACGCTCGGATCGCACGGGCGCCTAGAGC …

Neomyrtus pedunculata M333 NZFRI 29307 copy 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Neomyrtus pedunculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Dawson, M. I. 1987. Contributions to a chromosome atlas of the New Zealand flora---29 Myrtaceae. New Zealand J. Bot. 25: 367–369.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 314 records

Wild obs. + sensor5 830

Museum / vouchered483

Cultivated / captive1

Origin

Native67

Range

Area of Occupancy AOO5 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 476≤1 km 153≤10 km 4 911>10 km 20

5 560 georeferenced · 270 without coordinates

Open the mapobservation + sensor5 830

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 7≤1 km 12≤10 km 11>10 km 2

32 georeferenced · 451 without coordinates

Open the institutions mapphysical evidence483

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	233
Auckland, NZ	83
Wellington, NZ	76
Palmerston North, NZ	50
Rotorua, NZ	23
Hobart, AU	7
Museo Entomologico de Leonlocation not on record	7
Kew, GB	1
Canberra, AU	1

9 institutions · 481 of 483 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Neomyrtus pedunculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.70 °C 6.30–11.1

Seasonal swing summer↔winter12.3 °C

Max temp (day)12.7 °C 9.90–15.5

Min temp (night)4.20 °C 1.90–6.50

Precipitation130 mm/mo 130–131

Air humidity62.2 % 61.8–62.5

Moisture balance29.8 mm/mo 10.2–49.4

Vapour deficit441 Pa 374–508

Wind speed6.20 m/s 6.00–6.40

Cloud cover38.5 % 38.2–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neomyrtus pedunculata

At a glance

Sources10 archives

Size & morphology13

Life cycle & reproduction6

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 314 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 9 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 314 records