Neolitsea parvigemma

(Hayata) Kaneh. & Sasaki · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Neolitsea

At a glance

Occurrence records292

Data sources8

Biological traits16

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Neolitsea parvigemma's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility292 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS33 compounds

Occurrence & distributionGBIF292 records

DNA & barcodingNCBIsequences

01Narrative

Neolitsea parvigemma is a species of small to medium-sized tree in the family Lauraceae. It is endemic to Taiwan, and confined to the south central mountain regions of the island. A number of chemicals from N. parvigemma show interesting biological properties. The hydrodistillated leaf essential oil of N. parvigemma has antifungal and anti-wood-decay fungal properties Sesquiterpenes isolated from the stems have anti-inflammatory properties.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology8

Leaf length85 mm

Leaf length max90 mm

Leaf length min80 mm

Leaf width max40 mm

Leaf width min35 mm

Seed mass320 mg

Seed mass max320 mg

Seed mass min320 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment4

Climatesubtropical

Climberself-supporting

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition33 compounds

Compounds documented for Neolitsea parvigemma across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids11

Aporphine alkaloids $ Isoquinoline alkaloids5

Flavonols2

Cinnamic acid amides2

Lupane triterpenoids2

Documented compounds33 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Glaucine	present	LOTUS
(1R,7Z,9R)-9-hydroxy-3,8-dimethyl-5,14-dioxatricyclo[10.2.1.02,6]pentadeca-2(6),3,7,12(15)-tetraen-13-one	present	LOTUS
(1R,7Z,9S)-9-hydroxy-3,8-dimethyl-5,14-dioxatricyclo[10.2.1.02,6]pentadeca-2(6),3,7,12(15)-tetraen-13-one	present	LOTUS
(1R,9R)-9-hydroxy-3-methyl-8-methylidene-5,14-dioxatricyclo[10.2.1.02,6]pentadeca-2(6),3,12(15)-trien-13-one	present	LOTUS
(1S)-3,8-dimethyl-5,14-dioxatricyclo[10.2.1.02,6]pentadeca-2(6),3,8,12(15)-tetraen-13-one	present	LOTUS
(1S,6S,7S,13S,14S)-7-hydroxy-6,11-dimethyl-5,9,15,17-tetraoxapentacyclo[11.2.2.01,14.04,6.08,12]heptadeca-8(12),10-dien-16-one	present	LOTUS
(2S,3R)-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	LOTUS
(3Z)-5,10-dimethyl-8,14,16-trioxatetracyclo[10.2.2.01,13.07,11]hexadeca-3,7(11),9-trien-15-one	present	LOTUS
(4S)-4-hydroxy-3,5,5-trimethyl-4-[(E,3R)-3-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybut-1-enyl]cyclohex-2-en-1-one	present	LOTUS
(E)-3-(4-Hydroxy-3-methoxyphenyl)-N-(2-(4-hydroxy-3-methoxyphenyl)ethyl)-2-propenamide	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neolitsea parvigemma has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKMF651959.1 ↗837 bpTaiwan

ACGT

AAACCCTTCACTCTTGGATACAAGATACTCCTTCGTTGCATTTATTGCGATTCTCTCTCTACGAGTATTGGAATTCAAATAGTCTCATTA …

Neolitsea parvigemma maturase K gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type292 records

Wild obs. + sensor142

Museum / vouchered149

Cultivated / captive1

Origin

Native9

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 17≤1 km 4≤10 km 1>10 km 3

25 georeferenced · 117 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 149 records without

Open the institutions mapphysical evidence149

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	107
Taipei, TW	16
TAIElocation not on record	10
Taipei, TW	7
Beijing, CN	3
Edinburgh, GB	3
Saint Louis, US	2
EL PASO, US	1

8 institutions · 149 of 149 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)