Neolitsea dealbata

(R.Br.) Merr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Neolitsea

At a glance

Occurrence records5 066

Data sources11

Biological traits44

DNA specimens6

eDNA detections5

Sources11 archives

Databases and archives Neolitsea dealbata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 066 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Chemical compositionLOTUS · NPASS29 compounds

Occurrence & distributionGBIF5 066 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Neolitsea dealbata, also known as hairy-leaved bolly gum, is a shrub or tree, in the family Lauraceae, which is native to Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology19

Fruit length10 mm

⚠ sources differ — AusTraits: 10 mm · GIFT: 9 mm

Fruit width9.75 mm

⚠ sources differ — AusTraits: 9.75 mm · GIFT: 9 mm

Leaf length130 mm

Leaf length max180 mm

Leaf length min70 mm

Leaf mass255 mg

Leaf mass per area82.5 g/m2

Leaf size8 603 mm²

⚠ sources differ — TRY: 8 603 mm² · AusTraits: 5 592 mm²

Leaf width44.9 mm

Leaf width max80 mm

Leaf width min25 mm

Petiole length1.25 cm

Plant height15 m

⚠ sources differ — AusTraits: 15 m · TRY: 3.75 m

Plant height max12 m

Seed length6.5 mm

Seed mass155 mg

⚠ sources differ — TRY: 155 mg · AusTraits: 180 mg · GIFT: 146 mg

Seed mass max180 mg

Seed mass min112 mg

Seed width7 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timennyyyynnnnnn

Life formtree

Life spanperennial

Pollination syndromebeetle

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate

Woodinesswoody

Physiology & chemistry6

Leaf n19.96 mg/g

Leaf p1.15 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)12.0 mm²/mg

Wood density489 mg/cm³

03Chemical composition29 compounds

Compounds documented for Neolitsea dealbata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aporphine alkaloids $ Isoquinoline alkaloids6

Stigmastane steroids3

Ursane and Taraxastane triterpenoids2

Germacrane sesquiterpenoids2

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids2

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Boldine	present	LOTUS
(11R,12R)-11-methyl-11-oxido-3,5-dioxa-11-azoniapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaene	present	LOTUS
(11R,12R)-11-methyl-11-oxido-3,5-dioxa-11-azoniapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaene;2,2,2-trifluoroacetic acid	present	NPASS
(12R)-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaen-17-ol	present	LOTUS
(1S)-1-[(4-hydroxyphenyl)methyl]-7-methoxy-2-methyl-3,4-dihydro-1H-isoquinolin-8-ol	present	LOTUS
(1S)-1-[(4-hydroxyphenyl)methyl]-7-methoxy-2-methyl-3,4-dihydro-1H-isoquinolin-8-ol;2,2,2-trifluoroacetic acid	present	NPASS
(1S)-norjuziphine	present	NPASS
(3Z,7Z)-3,7-dimethyl-10-propan-2-ylidenecyclodeca-3,7-dien-1-one	present	LOTUS
(6Ar)-Normecambroline	present	NPASS
(6Ar)-Roemerine	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neolitsea dealbata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences5

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ124277.1 ↗604 bpAustralia

ACGT

GCTCGCGGCGCGCGGCCCCAGCGCCCCGACGAGCCCCGAACAACCCTTTGGGCGCGGCGAGCGCCAAGGAATAGAAGCGGAAAGGGCGGC …

Neolitsea dealbata internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type5 066 records

Wild obs. + sensor3 607

Museum / vouchered962

Cultivated / captive4

Other493

Origin

Native121

Introduced1

Range

Area of Occupancy AOO9 620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 2 822≤1 km 259≤10 km 82>10 km 104

3 267 georeferenced · 340 without coordinates

Open the mapobservation + sensor3 607

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 116≤1 km 124≤10 km 271>10 km 119

630 georeferenced · 332 without coordinates

Open the institutions mapphysical evidence962

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	320
Brisbane, AU	188
Mount Annan, AU	122
Museo Entomologico de Leonlocation not on record	88
Canberra, AU	78
Armidale, AU	38
John T. Waterhouse Herbariumlocation not on record	24
Kew, GB	15
Palmerston, AU	13
James Cook Townsvillelocation not on record	12
Honolulu, US	8
Adelaide, AU	6
NSW Dept of Planning, Industry and Environmentlocation not on record	6
Zürich, CH	4
La Trobe Universitylocation not on record	3
Wollongong, AU	2
CSIRO, Tropical Forest Research Centrelocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
AUAlocation not on record	1
ASUlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Edinburgh, GB	1
Parkville, AU	1

23 institutions · 934 of 962 vouchered records shown · 27 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Neolitsea dealbata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 17.5–21.2

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C 21.7–27.4

Min temp (night)14.4 °C 13.8–14.9

Precipitation118 mm/mo 36.1–129

Air humidity61.0 % 46.9–66.3

Moisture balance13.6 mm/mo -111–18.8

Vapour deficit823 Pa 677–1,464

Wind speed3.10 m/s 1.70–3.80

Cloud cover25.6 % 19.6–30.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neolitsea dealbata

At a glance

Sources11 archives

Size & morphology19

Life cycle & reproduction9

Diet & foraging1

Habitat & environment9

Physiology & chemistry6

Compound class profile5 classes

Documented compounds29 total

At a glance

Record type5 066 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 066 records