Neolitsea australiensis

Kosterm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Neolitsea

At a glance

Occurrence records1 214

Data sources8

Biological traits34

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Neolitsea australiensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF1 214 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Neolitsea australiensis, also known as the green bolly gum, is an Australian rainforest tree, in the laurel family. The specific epithet is derived from "Australia", and the Latin "ensis"; meaning "native of Australia".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length20 mm

Fruit width14 mm

Leaf length97.5 mm

Leaf length max130 mm

Leaf length min60 mm

Leaf mass162 mg

Leaf mass per area90.42 g/m2

Leaf size4 499 mm²

Leaf width44.3 mm

Leaf width max60 mm

Leaf width min20 mm

Petiole length2 cm

Plant height30 m

⚠ sources differ — AusTraits: 30 m · TRY: 1.2 m

Seed length6 mm

Seed width5.5 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timennyyynnnnnnn

Life formtree

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)16.14 mm²/mg

Wood density581 mg/cm³

03Chemical composition3 compounds

Compounds documented for Neolitsea australiensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Germacrane sesquiterpenoids2

Elemane sesquiterpenoids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(3Z,7Z)-3,7-dimethyl-10-propan-2-ylidenecyclodeca-3,7-dien-1-one	present	LOTUS
4-Isopropenyl-5-methyl-2-(1-methylethylidene)-5-vinylcyclohexanone	present	LOTUS
Furanogermenone	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neolitsea australiensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895651.1 ↗518 bpAustralia

ACGT

GATTGACTTATTATACTCCTGACTATGAAACCAAAAGTACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCTG …

Neolitsea australiensis voucher 1076418256 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type1 214 records

Wild obs. + sensor954

Museum / vouchered198

Cultivated / captive1

Other61

Origin

Native32

Range

Area of Occupancy AOO2 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 817≤1 km 55≤10 km 31>10 km 2

905 georeferenced · 49 without coordinates

Open the mapobservation + sensor954

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 22≤1 km 28≤10 km 63>10 km 28

141 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence198

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	44
Brisbane, AU	41
Mount Annan, AU	32
Canberra, AU	22
Museo Entomologico de Leonlocation not on record	21
John T. Waterhouse Herbariumlocation not on record	10
Armidale, AU	9
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Kew, GB	3
Hobart, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Palmerston, AU	1

12 institutions · 189 of 198 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Neolitsea australiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 19.3–19.3

Seasonal swing summer↔winter10.8 °C

Max temp (day)24.1 °C

Min temp (night)15.1 °C

Precipitation88.1 mm/mo

Air humidity60.6 %

Moisture balance-27.7 mm/mo

Vapour deficit896 Pa

Wind speed2.60 m/s

Cloud cover25.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neolitsea australiensis

At a glance

Sources8 archives

Size & morphology15

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Compound class profile2 classes

Documented compounds3 total

At a glance

Record type1 214 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 214 records