Neolitsea aciculata

(Blume) Koidz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Neolitsea

At a glance

Occurrence records1 201

Data sources12

Biological traits15

DNA specimens21

eDNA detections15

Sources12 archives

Databases and archives Neolitsea aciculata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 201 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS144 compounds

Occurrence & distributionGBIF1 201 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD · NCBI21 specimens

Genome at a glanceCCDB2n = 72

01Narrative

Neolitsea aciculata is a species of small evergreen tree (trunk up to 4 m) in the family Lauraceae. It is found in Japan and Taiwan. In Taiwan, it grows often in mixed coniferous and broad-leaved forests in valleys throughout the island. ''N. aciculata'' foliage ''N. aciculata'' trunk

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.59 m

Seed volume100 mm³

Seed volume max100 mm³

Seed volume min100 mm³

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment5

Climatesubtropical

Climberself-supporting

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry3

Leaf n17 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)18.16 mm²/mg

03Chemical composition144 compounds

Compounds documented for Neolitsea aciculata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids25

Carotenoids (C40, β-β)10

Lanostane, Tirucallane and Euphane triterpenoids6

Stigmastane steroids5

Elemane sesquiterpenoids4

Documented compounds144 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	LOTUS
(1aS,4R,5Z,10S,10aS)-4-Acetoxy-3,4,10,10a-tetrahydro-5,9-dimethyl-2H-10,1a-(epoxymethano)oxireno[4,5]cyclodeca[1,2-b]furan-12-one	present	LOTUS
(1R)-3,5,5-trimethyl-4-[(3E,5E,7E,9E,11E,13E,15E,17E)-3,7,12,16-tetramethyl-18-[(1R)-2,6,6-trimethylcyclohex-2-en-1-yl]octadeca-3,5,7,9,11,13,15,17-octaen-1-ynyl]cyclohex-3-en-1-ol	present	NPASS
(1R,2S,8R,12S)-12-ethenyl-2-hydroxy-5,12-dimethyl-9-methylidene-3,11-dioxatricyclo[6.3.1.02,6]dodec-5-ene-4,10-dione	present	LOTUS
(1R,4R,6R,13R,14R)-6,11-dimethyl-5,9,15,17-tetraoxapentacyclo[11.2.2.01,14.04,6.08,12]heptadeca-8(12),10-dien-16-one	present	LOTUS
(1R,4R,7R,12R,13S)-5,10-dimethyl-8,14,16,17-tetraoxapentacyclo[10.2.2.14,7.01,13.07,11]heptadeca-5,10-diene-9,15-dione	present	LOTUS
(1S,3R,6S,8R,11R,12S,15R,16R)-15-[(2R)-6,6-dimethyl-5-methylideneheptan-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(1S,3R,6S,8R,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methyl-5-methylideneheptan-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(1S,3R,6S,8R,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(1S,3R,6S,8R,11S,12S,15R,16R)-15-[(2R,5S)-5-ethyl-6-methylhept-6-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neolitsea aciculata has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes4

GenBank sequences10

eDNA detections15

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC693158.1 ↗599 bpJapan · 2002

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAAGTACTGATATTTTGGCAGC …

Neolitsea aciculata TF<JPN>:TW019570 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL9★ITStrnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Neolitsea aciculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 721×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Okada, H. & R. TANAKA. 1975. Karyological studies in some species of Lauraceae. Taxon 24: 271–280.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 201 records

Wild obs. + sensor589

Museum / vouchered599

Cultivated / captive9

Other4

Origin

Native1

Range

Area of Occupancy AOO1 976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy4% within 1 km

≤100 m 11≤1 km 4≤10 km 193>10 km 183

391 georeferenced · 198 without coordinates

Open the mapobservation + sensor589

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 4≤1 km 26≤10 km 28

58 georeferenced · 541 without coordinates

Open the institutions mapphysical evidence599

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 9

9 georeferenced

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nishihara, JP	126
Odawara, JP	89
Taipei, TW	75
Kochi, JP	49
Tokushima, JP	37
Sanda, JP	32
Nagano City, JP	22
Osaka, JP	18
FFPRIlocation not on record	18
Herbarium of the Department of Botany, University of Tokyolocation not on record	15
Forestry and Forest Products Research Institutelocation not on record	9
KR	9
Elocation not on record	9
Cambridge, US	8
Chiba, JP	7
Universidad Católica de Santa Maríalocation not on record	6
Kagoshima, JP	5
Kyoto Universitylocation not on record	4
Sendai, JP	4
NSMKlocation not on record	3
Taipei, TW	3
Toyama, JP	3
Saint Louis, US	3
Wlocation not on record	3
Omachi Alpine Museumlocation not on record	2
Toyota city nature sanctuarylocation not on record	2
Edinburgh, GB	2
KIRMlocation not on record	1
Bando, JP	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Stellenboschlocation not on record	1
National Institute of Biological Resourceslocation not on record	1
Herbarium of the Kyushu University Museum (FU)location not on record	1
Burlington, US	1
Sagamihara, JP	1
Guangzhou, CN	1
CASlocation not on record	1
Nagatoro-machi, Chichibu-gun, JP	1
KURAlocation not on record	1
Shinshu Universitylocation not on record	1
TAIElocation not on record	1
Otaru, JP	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

43 institutions · 579 of 599 vouchered records shown · 19 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Neolitsea aciculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 8.00–25.1

Seasonal swing summer↔winter19.0 °C

Max temp (day)21.2 °C 9.60–25.7

Min temp (night)15.9 °C 6.50–24.2

Precipitation244 mm/mo 171–385

Air humidity63.5 % 58.3–67.1

Moisture balance173 mm/mo

Vapour deficit800 Pa 450–1,168

Wind speed3.30 m/s

Cloud cover39.5 % 32.3–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neolitsea aciculata

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction3

Habitat & environment5

Physiology & chemistry3

Compound class profile5 classes

Documented compounds144 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 201 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 201 records