Neolecta vitellina

(Bres.) Korf & J.K.Rogers · species

image placeholder — illustration coming later

Fungi/Ascomycota/Neolectomycetes/Neolectales/Neolectaceae/Neolecta

At a glance

Occurrence records558

Data sources8

Biological traits0

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Neolecta vitellina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility558 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF558 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Neolecta vitellina is a species of fungus belonging to the family Neolectaceae. It has cosmopolitan distribution.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neolecta vitellina has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOP178219.1 ↗302 bpUSA · 2015

ACGT

AACGCACATTGCACTCCTTGGTATTCCGGGGAGTATGCCTGTTTGAGCGTCAGCAATCCCTCAATCCTCCAAGGGTATTTATTTATTCTC …

Neolecta vitellina voucher DBG:F-028523 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type558 records

Wild obs. + sensor361

Museum / vouchered197

Range

Area of Occupancy AOO1 500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 213≤1 km 75≤10 km 22>10 km 17

327 georeferenced · 34 without coordinates

Open the mapobservation + sensor361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 46≤1 km 61≤10 km 36>10 km 9

152 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	35
SLU Artdatabankenlocation not on record	25
Uppsala, SE	21
Denver, US	17
Oulu, FI	13
Catholic University of Pekinglocation not on record	12
Ann Arbor, US	8
Université de Montréal Biodiversity Centrelocation not on record	7
Helsinki, FI	6
Toronto, CA	6
Bronx, US	4
Osaka, JP	3
TROMlocation not on record	2
CA	2
Fort Hayslocation not on record	2
nsnflocation not on record	2
Vancouver, CA	2
Copenhagen, DK	2
Rene Pomerleau Herbariumlocation not on record	1
Tartu, EE	1
Stockholm, SE	1
TENN-Flocation not on record	1
CJBGlocation not on record	1
WTUlocation not on record	1
Chapel Hill, US	1
Umeå Universitylocation not on record	1
WU-MYClocation not on record	1
Bando, JP	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
PRClocation not on record	1
PHlocation not on record	1
Durham, US	1
TUR-Alocation not on record	1
Trondheim, NO	1

34 institutions · 185 of 197 vouchered records shown · 12 without an institution code

09Environmental DNA7 detections

Where the DNA of Neolecta vitellina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.40 °C 4.60–12.2

Seasonal swing summer↔winter27.8 °C

Max temp (day)14.0 °C 11.0–16.9

Min temp (night)3.80 °C -0.6–8.20

Precipitation89.8 mm/mo 77.2–102

Air humidity54.9 % 49.5–60.3

Moisture balance7.00 mm/mo 1.20–12.7

Vapour deficit500 Pa 436–565

Wind speed2.90 m/s 2.30–3.60

Cloud cover37.8 % 28.6–46.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)