Neokochia americana

(S.Watson) G.L.Chu & S.C.Sand. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Neokochia

At a glance

Occurrence records269

Data sources9

Biological traits91

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Neokochia americana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility269 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources91 traits

Occurrence & distributionGBIF269 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Neokochia americana (syn. Bassia americana, Kochia americana) is a species of flowering plant in the amaranth family, subfamily Camphorosmoideae,Gudrun Kadereit & Helmut Freitag: Molecular phylogeny of Camphorosmeae (Camphorosmoideae, Chenopodiaceae): Implications for biogeography, evolution of C4-photosynthesis and taxonomy, In: Taxon, Volume 60 (1), 2011, p. 51-78. known by the common name green molly.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFTUSDA

Size & morphology1

Plant height0.61 m

Life cycle & reproduction23

Bloom periodLate Summer

Coppice potentialYes

Flower colourwhite

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDARapid

Life formsubshrub

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorHigh

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Fall

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub

Growth form USDAMultiple Stem

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min12 in

Shape and orientationRounded

Small grainNo

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

Physiology & chemistry20

Anaerobic toleranceLow

C:N ratioLow

Caco3 toleranceHigh

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min150 days

Moisture useLow

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max10 in

Precipitation min5 in

Protein potentialMedium

Salinity toleranceHigh

Shade toleranceHigh

Soil pH max8.5 pH

Soil pH min7 pH

Temperature min-33 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalHigh

Palatable graze animalMedium

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound500 000 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

Height at 20yr0.61 m

Planting density max1 700 per acre

Planting density min1 200 per acre

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neokochia americana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY489210.1 ↗722 bpUSA

ACGT

AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGATTGACTAGTGAACTCGTTCATCATGC …

Kochia americana 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Neokochia americana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 361×CCDB · Automatic manuscript search

CCDB · Automatic manuscript search — B. Lee,M. Kim,R. R. Wang and B. Waldron. 2005. "Relationships among 3 Kochia species based on PCR-generated molecular sequences and molecular cytogenetics.". Genome 48 6:1104-15.

08Occurrence & distribution

Record type269 records

Wild obs. + sensor108

Museum / vouchered161

Range

Area of Occupancy AOO936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 64≤1 km 5≤10 km 1>10 km 8

78 georeferenced · 30 without coordinates

Open the mapobservation + sensor108

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 16≤1 km 25≤10 km 19>10 km 4

64 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	80
Caldwell, US	18
Pullman, US	14
Corvallis, US	11
ASUlocation not on record	6
Albuquerque, US	5
Denver, US	4
Claremont, US	3
Davis, US	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
Provo, US	2
Santa Barbara, US	2
Boise, US	1
Bend, US	1
Flagstaff, US	1
Chadron, US	1
Logan, US	1
Eastern Nevada Landscape Coalitionlocation not on record	1
Wlocation not on record	1
McWane Science Centerlocation not on record	1
Grand Junction, US	1

21 institutions · 160 of 161 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Neokochia americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)