Neoholmgrenia andina

(Nutt.) W.L.Wagner & Hoch · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Neoholmgrenia

At a glance

Occurrence records262

Data sources10

Biological traits13

DNA specimens11

eDNA detections7

Sources10 archives

Databases and archives Neoholmgrenia andina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF262 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Neoholmgrenia andina is a species of evening primrose known by the common name Blackfoot River evening primrose. It is native to western North America, including southern Canada and much of the western United States, where it is a plant of mountains, and sagebrush plateaus. It is a small annual herb growing a hairy, branching stem generally under 15 centimeters tall. The bunched leaves are widely lance-shaped and 1 to 3 centimeters long. The inflorescence bears one or more flowers with usually four tiny bright yellow petals. The fruit is a flat capsule up to a centimeter long.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.07 mg

Seed mass max0.07 mg

Seed mass min0.07 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neoholmgrenia andina has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes4

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG235001.1 ↗237 bpCanada · 1996

ACGT

CCCAACCCCTGCACCCCAAAAAGGTGCTCGGGCCATGGGTACGGAAGTTGGCCTCCCGTGCTCCTAGAGCGCGGCTGGTCTAAAATTGAG …

Neoholmgrenia andina voucher CCDB-24910-F03 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★rbcLa★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Neoholmgrenia andina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 141×CCDB · Cave1958

CCDB · Cave1958 — Lewis et al. 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type262 records

Wild obs. + sensor107

Museum / vouchered155

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 73≤1 km 3≤10 km 1>10 km 3

80 georeferenced · 27 without coordinates

Open the mapobservation + sensor107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 21≤1 km 21≤10 km 24>10 km 7

73 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	33
Caldwell, US	21
Henderson, US	13
Provo, US	12
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	9
Bronx, US	8
Riverside, US	5
Flagstaff, US	5
Vancouver, CA	4
WTUlocation not on record	4
CASlocation not on record	4
Boise, US	4
Pullman, US	3
Claremont, US	3
University of British Columbia, Herbariumlocation not on record	2
San Jose, US	2
Phoenix, US	2
Pocatello, US	2
Logan, US	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	1
University of Stellenboschlocation not on record	1
Moscow, US	1
Madison, US	1
Bloomington, US	1
Chadron, US	1

26 institutions · 144 of 155 vouchered records shown · 11 without an institution code

09Environmental DNA7 detections

Where the DNA of Neoholmgrenia andina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Plants few in slightly alkaline meadow, at e…in Stipa - sagebrush hills, on an eroded slo…Dry, light soil in sagebrush flats, 100 m NW…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 8.50–14.9

Seasonal swing summer↔winter24.6 °C

Max temp (day)18.1 °C 14.2–20.6

Min temp (night)5.60 °C 1.60–7.90

Precipitation58.7 mm/mo 43.4–66.2

Air humidity53.2 % 51.5–55.1

Moisture balance-53.9 mm/mo -79.6–-46.0

Vapour deficit650 Pa 529–814

Wind speed1.90 m/s 1.80–2.50

Cloud cover40.2 % 38.7–40.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)