Neohenricia sibbettii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Neohenricia

At a glance

Occurrence records27

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Neohenricia sibbettii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF27 records

DNA & barcodingNCBIsequences

01Narrative

Neohenricia sibbettii, called the coral plant, is a species of flowering plant in the genus Neohenricia, native to South Africa. A succulent, it has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height max0.01 m

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 380 m

Elevation min1 120 m

Epiphyteterrestrial

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neohenricia sibbettii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF349147.1 ↗325 bpUSA · 2016

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCGGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Neohenricia sibbettii isolate AD7LN21 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor14

Museum / vouchered13

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 7≤1 km 3≤10 km 1>10 km 1

12 georeferenced · 2 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African National Biodiversity Institutelocation not on record	4
Pretoria, ZA	4
University of Stellenboschlocation not on record	4

3 institutions · 12 of 13 vouchered records shown · 1 without an institution code